FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635448_at:

>probe:Drosophila_2:1635448_at:380:651; Interrogation_Position=1008; Antisense; TCACAAATGGCTTCTCGGGCTCAGA
>probe:Drosophila_2:1635448_at:727:59; Interrogation_Position=1043; Antisense; ATGTGCCGGAATGCTTCAGTTTACC
>probe:Drosophila_2:1635448_at:496:437; Interrogation_Position=1072; Antisense; GAGGCAGCTCATCACGTCCAGAGAT
>probe:Drosophila_2:1635448_at:36:99; Interrogation_Position=1093; Antisense; AGATCCGTCAGCTACAGCGCTTGAT
>probe:Drosophila_2:1635448_at:55:461; Interrogation_Position=1145; Antisense; GATTTGCTGGGCTCGCACTTAAAAA
>probe:Drosophila_2:1635448_at:124:617; Interrogation_Position=1185; Antisense; TGCACACGAGCAGCCTATTCTTAGA
>probe:Drosophila_2:1635448_at:682:413; Interrogation_Position=1235; Antisense; GACCATTGTTTATTCAAGCTCCCGA
>probe:Drosophila_2:1635448_at:613:645; Interrogation_Position=1248; Antisense; TCAAGCTCCCGATATATCCAACTTA
>probe:Drosophila_2:1635448_at:199:105; Interrogation_Position=721; Antisense; AGACTCATTTTTGCGATCTCGAAAC
>probe:Drosophila_2:1635448_at:710:183; Interrogation_Position=743; Antisense; AACATGAACGACCACGAGGCTACCG
>probe:Drosophila_2:1635448_at:472:437; Interrogation_Position=758; Antisense; GAGGCTACCGCCATGATGAAGACCC
>probe:Drosophila_2:1635448_at:661:595; Interrogation_Position=795; Antisense; TGTGGGATGGCCTCAGCACGAACGC
>probe:Drosophila_2:1635448_at:61:201; Interrogation_Position=815; Antisense; AACGCCAACTCGACGGTGATTGTGA
>probe:Drosophila_2:1635448_at:672:171; Interrogation_Position=935; Antisense; AAAGACATCCTGAAGCTGATCCTCC

Paste this into a BLAST search page for me
TCACAAATGGCTTCTCGGGCTCAGAATGTGCCGGAATGCTTCAGTTTACCGAGGCAGCTCATCACGTCCAGAGATAGATCCGTCAGCTACAGCGCTTGATGATTTGCTGGGCTCGCACTTAAAAATGCACACGAGCAGCCTATTCTTAGAGACCATTGTTTATTCAAGCTCCCGATCAAGCTCCCGATATATCCAACTTAAGACTCATTTTTGCGATCTCGAAACAACATGAACGACCACGAGGCTACCGGAGGCTACCGCCATGATGAAGACCCTGTGGGATGGCCTCAGCACGAACGCAACGCCAACTCGACGGTGATTGTGAAAAGACATCCTGAAGCTGATCCTCC

Full Affymetrix probeset data:

Annotations for 1635448_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720