Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635450_a_at:

>probe:Drosophila_2:1635450_a_at:196:401; Interrogation_Position=442; Antisense; GACAGTGGCGACATATTCACCCAAT
>probe:Drosophila_2:1635450_a_at:165:293; Interrogation_Position=510; Antisense; CGCTATCCGTAGCAAGGTGGGCATA
>probe:Drosophila_2:1635450_a_at:45:519; Interrogation_Position=526; Antisense; GTGGGCATATCCAATGGCCTGGCCT
>probe:Drosophila_2:1635450_a_at:130:203; Interrogation_Position=592; Antisense; AACCACGAGGTATTGGCCTATGACT
>probe:Drosophila_2:1635450_a_at:92:57; Interrogation_Position=611; Antisense; ATGACTACAATCAGAGCACCGGCGC
>probe:Drosophila_2:1635450_a_at:664:199; Interrogation_Position=643; Antisense; AACCCAAAGGTCATCTTCGATCTGA
>probe:Drosophila_2:1635450_a_at:310:463; Interrogation_Position=672; Antisense; GATTCGGCCCGAAGGACCATTGTTC
>probe:Drosophila_2:1635450_a_at:683:3; Interrogation_Position=690; Antisense; ATTGTTCCCTGATGGCATGACCGTA
>probe:Drosophila_2:1635450_a_at:655:347; Interrogation_Position=704; Antisense; GCATGACCGTAGACACCGATGGCAA
>probe:Drosophila_2:1635450_a_at:314:63; Interrogation_Position=749; Antisense; ATGGTGGCACCGTCTTCAAGGTCAA
>probe:Drosophila_2:1635450_a_at:513:161; Interrogation_Position=821; Antisense; AAATCACCTCGGTGGCTTTTGGAGG
>probe:Drosophila_2:1635450_a_at:225:597; Interrogation_Position=867; Antisense; TGTGACAACCGCCAACAAGTTCGAC
>probe:Drosophila_2:1635450_a_at:59:495; Interrogation_Position=922; Antisense; GTCACTGGGCTCAATGCCAAGGGTT
>probe:Drosophila_2:1635450_a_at:428:671; Interrogation_Position=946; Antisense; TACGCCGGCGTTAATTTGAAGATCT

Paste this into a BLAST search page for me
GACAGTGGCGACATATTCACCCAATCGCTATCCGTAGCAAGGTGGGCATAGTGGGCATATCCAATGGCCTGGCCTAACCACGAGGTATTGGCCTATGACTATGACTACAATCAGAGCACCGGCGCAACCCAAAGGTCATCTTCGATCTGAGATTCGGCCCGAAGGACCATTGTTCATTGTTCCCTGATGGCATGACCGTAGCATGACCGTAGACACCGATGGCAAATGGTGGCACCGTCTTCAAGGTCAAAAATCACCTCGGTGGCTTTTGGAGGTGTGACAACCGCCAACAAGTTCGACGTCACTGGGCTCAATGCCAAGGGTTTACGCCGGCGTTAATTTGAAGATCT

Full Affymetrix probeset data:

Annotations for 1635450_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime