FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635453_at:

>probe:Drosophila_2:1635453_at:270:601; Interrogation_Position=1045; Antisense; TGTATGTCCGCCTTCGAGTACATGG
>probe:Drosophila_2:1635453_at:723:427; Interrogation_Position=1060; Antisense; GAGTACATGGGCACCGACTTCTGGA
>probe:Drosophila_2:1635453_at:477:327; Interrogation_Position=1091; Antisense; GCGATGTCTTCATTGGCCAGTACTA
>probe:Drosophila_2:1635453_at:564:313; Interrogation_Position=1106; Antisense; GCCAGTACTACACCGAGTTCGATTT
>probe:Drosophila_2:1635453_at:246:717; Interrogation_Position=1123; Antisense; TTCGATTTGGGCAACAACCGCATTG
>probe:Drosophila_2:1635453_at:17:503; Interrogation_Position=1159; Antisense; GTCGCCTAATTAACGATCCGCAATT
>probe:Drosophila_2:1635453_at:2:631; Interrogation_Position=618; Antisense; TCCGTTCTACAACATGGTGTCCCAG
>probe:Drosophila_2:1635453_at:622:67; Interrogation_Position=686; Antisense; ATGGCACCTCCACTATGGGTGGTGA
>probe:Drosophila_2:1635453_at:285:517; Interrogation_Position=704; Antisense; GTGGTGAACTCATCTTCGGTGGCTC
>probe:Drosophila_2:1635453_at:415:669; Interrogation_Position=784; Antisense; TACTGGCAGTTCACCATGGCTGGAT
>probe:Drosophila_2:1635453_at:656:585; Interrogation_Position=804; Antisense; TGGATCCTCCATTGACGGTTACTCG
>probe:Drosophila_2:1635453_at:479:475; Interrogation_Position=821; Antisense; GTTACTCGCTGTGTGATGATTGCCA
>probe:Drosophila_2:1635453_at:720:521; Interrogation_Position=877; Antisense; GTGGCTCCCTACAATGCTTACATTA
>probe:Drosophila_2:1635453_at:456:77; Interrogation_Position=929; Antisense; AGGATGGCTATCTGGACTGCTCAAG

Paste this into a BLAST search page for me
TGTATGTCCGCCTTCGAGTACATGGGAGTACATGGGCACCGACTTCTGGAGCGATGTCTTCATTGGCCAGTACTAGCCAGTACTACACCGAGTTCGATTTTTCGATTTGGGCAACAACCGCATTGGTCGCCTAATTAACGATCCGCAATTTCCGTTCTACAACATGGTGTCCCAGATGGCACCTCCACTATGGGTGGTGAGTGGTGAACTCATCTTCGGTGGCTCTACTGGCAGTTCACCATGGCTGGATTGGATCCTCCATTGACGGTTACTCGGTTACTCGCTGTGTGATGATTGCCAGTGGCTCCCTACAATGCTTACATTAAGGATGGCTATCTGGACTGCTCAAG

Full Affymetrix probeset data:

Annotations for 1635453_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720