FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635456_at:

>probe:Drosophila_2:1635456_at:74:211; Interrogation_Position=1013; Antisense; AAGAATGCCTACGAGGGCGCCCAGT
>probe:Drosophila_2:1635456_at:726:131; Interrogation_Position=1055; Antisense; ACCGATCCCCAGCTGAAGGAAGTCA
>probe:Drosophila_2:1635456_at:710:495; Interrogation_Position=1076; Antisense; GTCACCGGCGAGTACTTCAATGATT
>probe:Drosophila_2:1635456_at:473:357; Interrogation_Position=1112; Antisense; GCAAGTTCGGTGACGGGCCAAGACA
>probe:Drosophila_2:1635456_at:502:389; Interrogation_Position=1181; Antisense; GAAAGCGTTACCAAGCTAACCGTCG
>probe:Drosophila_2:1635456_at:336:89; Interrogation_Position=1215; Antisense; AGTACGGCTTGGATTTGCAGCTGGA
>probe:Drosophila_2:1635456_at:432:377; Interrogation_Position=1342; Antisense; GAAGCAGCCGTAGTCATTGGAGTGA
>probe:Drosophila_2:1635456_at:73:589; Interrogation_Position=1359; Antisense; TGGAGTGATTTATGCCTGGCACGCG
>probe:Drosophila_2:1635456_at:311:321; Interrogation_Position=1384; Antisense; GCCCGAGTTCCTTGGAGACTGCCAA
>probe:Drosophila_2:1635456_at:347:405; Interrogation_Position=1400; Antisense; GACTGCCAACTGCAACGTCTATTTG
>probe:Drosophila_2:1635456_at:460:135; Interrogation_Position=1414; Antisense; ACGTCTATTTGCATTCGGTTTAACA
>probe:Drosophila_2:1635456_at:374:15; Interrogation_Position=1493; Antisense; ATTTTATGTGGACCCCTGACTTTGT
>probe:Drosophila_2:1635456_at:33:613; Interrogation_Position=975; Antisense; TGAAGGCGGTCACCTATCCGTGGAT
>probe:Drosophila_2:1635456_at:279:47; Interrogation_Position=990; Antisense; ATCCGTGGATGTGGCTGTTCATGAA

Paste this into a BLAST search page for me
AAGAATGCCTACGAGGGCGCCCAGTACCGATCCCCAGCTGAAGGAAGTCAGTCACCGGCGAGTACTTCAATGATTGCAAGTTCGGTGACGGGCCAAGACAGAAAGCGTTACCAAGCTAACCGTCGAGTACGGCTTGGATTTGCAGCTGGAGAAGCAGCCGTAGTCATTGGAGTGATGGAGTGATTTATGCCTGGCACGCGGCCCGAGTTCCTTGGAGACTGCCAAGACTGCCAACTGCAACGTCTATTTGACGTCTATTTGCATTCGGTTTAACAATTTTATGTGGACCCCTGACTTTGTTGAAGGCGGTCACCTATCCGTGGATATCCGTGGATGTGGCTGTTCATGAA

Full Affymetrix probeset data:

Annotations for 1635456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720