Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635458_at:

>probe:Drosophila_2:1635458_at:603:167; Interrogation_Position=116; Antisense; AAATGGAACGTTCCATCAAGGAGCT
>probe:Drosophila_2:1635458_at:518:653; Interrogation_Position=131; Antisense; TCAAGGAGCTGACCAGTTCGATCCT
>probe:Drosophila_2:1635458_at:130:611; Interrogation_Position=140; Antisense; TGACCAGTTCGATCCTGGCCATGAG
>probe:Drosophila_2:1635458_at:673:715; Interrogation_Position=147; Antisense; TTCGATCCTGGCCATGAGTGGAGCT
>probe:Drosophila_2:1635458_at:291:57; Interrogation_Position=160; Antisense; ATGAGTGGAGCTACTACCGGCTTTA
>probe:Drosophila_2:1635458_at:327:519; Interrogation_Position=164; Antisense; GTGGAGCTACTACCGGCTTTAGACC
>probe:Drosophila_2:1635458_at:181:481; Interrogation_Position=202; Antisense; GTTTGGCCTGAAGATCTTCATGCTT
>probe:Drosophila_2:1635458_at:613:91; Interrogation_Position=22; Antisense; AGTATTTTCATTTTTCTGGCCCTGA
>probe:Drosophila_2:1635458_at:414:17; Interrogation_Position=31; Antisense; ATTTTTCTGGCCCTGACTTGTGTCC
>probe:Drosophila_2:1635458_at:188:577; Interrogation_Position=39; Antisense; GGCCCTGACTTGTGTCCTATTTATG
>probe:Drosophila_2:1635458_at:544:597; Interrogation_Position=51; Antisense; TGTCCTATTTATGGGTCAGAGCTGC
>probe:Drosophila_2:1635458_at:274:17; Interrogation_Position=57; Antisense; ATTTATGGGTCAGAGCTGCTTGGCG
>probe:Drosophila_2:1635458_at:108:729; Interrogation_Position=76; Antisense; TTGGCGGCTCCCTCGGCCGATGATT
>probe:Drosophila_2:1635458_at:167:293; Interrogation_Position=93; Antisense; CGATGATTTGGCCAAATTTGGTGAA

Paste this into a BLAST search page for me
AAATGGAACGTTCCATCAAGGAGCTTCAAGGAGCTGACCAGTTCGATCCTTGACCAGTTCGATCCTGGCCATGAGTTCGATCCTGGCCATGAGTGGAGCTATGAGTGGAGCTACTACCGGCTTTAGTGGAGCTACTACCGGCTTTAGACCGTTTGGCCTGAAGATCTTCATGCTTAGTATTTTCATTTTTCTGGCCCTGAATTTTTCTGGCCCTGACTTGTGTCCGGCCCTGACTTGTGTCCTATTTATGTGTCCTATTTATGGGTCAGAGCTGCATTTATGGGTCAGAGCTGCTTGGCGTTGGCGGCTCCCTCGGCCGATGATTCGATGATTTGGCCAAATTTGGTGAA

Full Affymetrix probeset data:

Annotations for 1635458_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime