FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635461_at:

>probe:Drosophila_2:1635461_at:540:429; Interrogation_Position=1027; Antisense; GAGTATTACGACTTGGTGCACACCA
>probe:Drosophila_2:1635461_at:353:555; Interrogation_Position=1053; Antisense; GGACCACATCATAGTCATGGGCGAC
>probe:Drosophila_2:1635461_at:283:3; Interrogation_Position=1081; Antisense; ATTGGTGATGCAGACATGGCCTCCG
>probe:Drosophila_2:1635461_at:516:271; Interrogation_Position=1125; Antisense; CATCATGAAAATCGGCTTCCTCTTC
>probe:Drosophila_2:1635461_at:452:585; Interrogation_Position=1181; Antisense; TGGACACCTTTGACATAGTGCTCGT
>probe:Drosophila_2:1635461_at:706:25; Interrogation_Position=1195; Antisense; ATAGTGCTCGTCGATGACCAGACCA
>probe:Drosophila_2:1635461_at:198:415; Interrogation_Position=1210; Antisense; GACCAGACCATGGACGTGCCCAGGA
>probe:Drosophila_2:1635461_at:439:719; Interrogation_Position=1303; Antisense; TTCCCGCAGGGAGTTCACGAATTCA
>probe:Drosophila_2:1635461_at:343:259; Interrogation_Position=1326; Antisense; CACTCTGAAATGTACTCGTGCCGCT
>probe:Drosophila_2:1635461_at:476:69; Interrogation_Position=1368; Antisense; AGGCTAGTTGCTGACCGGAACACAA
>probe:Drosophila_2:1635461_at:122:223; Interrogation_Position=919; Antisense; AAGGTAGTCTCGAACTTTCTTCAGT
>probe:Drosophila_2:1635461_at:205:645; Interrogation_Position=939; Antisense; TCAGTTCCGGGATGGCCTTCTAGAT
>probe:Drosophila_2:1635461_at:574:713; Interrogation_Position=956; Antisense; TTCTAGATGGCTTTCAGCAGCCGAT
>probe:Drosophila_2:1635461_at:684:113; Interrogation_Position=971; Antisense; AGCAGCCGATGATACACACCTTCAA

Paste this into a BLAST search page for me
GAGTATTACGACTTGGTGCACACCAGGACCACATCATAGTCATGGGCGACATTGGTGATGCAGACATGGCCTCCGCATCATGAAAATCGGCTTCCTCTTCTGGACACCTTTGACATAGTGCTCGTATAGTGCTCGTCGATGACCAGACCAGACCAGACCATGGACGTGCCCAGGATTCCCGCAGGGAGTTCACGAATTCACACTCTGAAATGTACTCGTGCCGCTAGGCTAGTTGCTGACCGGAACACAAAAGGTAGTCTCGAACTTTCTTCAGTTCAGTTCCGGGATGGCCTTCTAGATTTCTAGATGGCTTTCAGCAGCCGATAGCAGCCGATGATACACACCTTCAA

Full Affymetrix probeset data:

Annotations for 1635461_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720