Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635462_at:

>probe:Drosophila_2:1635462_at:602:113; Interrogation_Position=2001; Antisense; AGCATAATGTGCTCCGAATTGTAGG
>probe:Drosophila_2:1635462_at:593:333; Interrogation_Position=2011; Antisense; GCTCCGAATTGTAGGATTTAGTGTT
>probe:Drosophila_2:1635462_at:191:671; Interrogation_Position=2046; Antisense; TATATTTAGGTATAACTAGCCCTCC
>probe:Drosophila_2:1635462_at:209:657; Interrogation_Position=2058; Antisense; TAACTAGCCCTCCTAACAAATTGTT
>probe:Drosophila_2:1635462_at:414:491; Interrogation_Position=2090; Antisense; GTAAATACTATTAAGTCGCACACTA
>probe:Drosophila_2:1635462_at:596:501; Interrogation_Position=2104; Antisense; GTCGCACACTAGTCAAACAACAACA
>probe:Drosophila_2:1635462_at:423:183; Interrogation_Position=2162; Antisense; AAAACCACAGCAAAGAACCATTCAA
>probe:Drosophila_2:1635462_at:3:381; Interrogation_Position=2176; Antisense; GAACCATTCAATTCAGATCAATTAA
>probe:Drosophila_2:1635462_at:19:179; Interrogation_Position=2234; Antisense; AAGTCACTTAATGCGTTACAAAATC
>probe:Drosophila_2:1635462_at:339:185; Interrogation_Position=2253; Antisense; AAAATCGAGCATCGTAATCCCCTAC
>probe:Drosophila_2:1635462_at:511:21; Interrogation_Position=2318; Antisense; ATATTTATTTATGGTAGGGCAGCGA
>probe:Drosophila_2:1635462_at:699:481; Interrogation_Position=2331; Antisense; GTAGGGCAGCGAGGGTTTATTAATT
>probe:Drosophila_2:1635462_at:555:291; Interrogation_Position=2356; Antisense; CGTCAATTGAGCGAACTATTTATTT
>probe:Drosophila_2:1635462_at:543:611; Interrogation_Position=2403; Antisense; TGAAATTCACACAAACAAGCACGAA

Paste this into a BLAST search page for me
AGCATAATGTGCTCCGAATTGTAGGGCTCCGAATTGTAGGATTTAGTGTTTATATTTAGGTATAACTAGCCCTCCTAACTAGCCCTCCTAACAAATTGTTGTAAATACTATTAAGTCGCACACTAGTCGCACACTAGTCAAACAACAACAAAAACCACAGCAAAGAACCATTCAAGAACCATTCAATTCAGATCAATTAAAAGTCACTTAATGCGTTACAAAATCAAAATCGAGCATCGTAATCCCCTACATATTTATTTATGGTAGGGCAGCGAGTAGGGCAGCGAGGGTTTATTAATTCGTCAATTGAGCGAACTATTTATTTTGAAATTCACACAAACAAGCACGAA

Full Affymetrix probeset data:

Annotations for 1635462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime