FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635463_at:

>probe:Drosophila_2:1635463_at:571:165; Interrogation_Position=102; Antisense; AAATCGTGCACGTTTATCCTCTGGT
>probe:Drosophila_2:1635463_at:671:683; Interrogation_Position=116; Antisense; TATCCTCTGGTTAAGCACACCGATA
>probe:Drosophila_2:1635463_at:327:99; Interrogation_Position=160; Antisense; AGAGGCCATTGAACTGTCCATTACC
>probe:Drosophila_2:1635463_at:689:667; Interrogation_Position=197; Antisense; TACTCATCGAACTACGAGCACGCTG
>probe:Drosophila_2:1635463_at:361:421; Interrogation_Position=212; Antisense; GAGCACGCTGCCAAAATCATCAAGG
>probe:Drosophila_2:1635463_at:609:109; Interrogation_Position=249; Antisense; AGAAGTTCGGCATCTACTGGCATGT
>probe:Drosophila_2:1635463_at:414:509; Interrogation_Position=27; Antisense; GTGATAGTCCTTCCAACATTCGTTG
>probe:Drosophila_2:1635463_at:30:373; Interrogation_Position=284; Antisense; GAAGGGTTCGGCTTTGAGGTCTCCT
>probe:Drosophila_2:1635463_at:168:191; Interrogation_Position=320; Antisense; AACATTCTTTATCTGTTCTTCGCCG
>probe:Drosophila_2:1635463_at:56:43; Interrogation_Position=356; Antisense; ATCGTGCTGTGGAAGTGCTCCTGAA
>probe:Drosophila_2:1635463_at:446:219; Interrogation_Position=368; Antisense; AAGTGCTCCTGAATGCGGGTCAGCA
>probe:Drosophila_2:1635463_at:580:715; Interrogation_Position=45; Antisense; TTCGTTGGTGAATCGCAGACATGGC
>probe:Drosophila_2:1635463_at:523:665; Interrogation_Position=469; Antisense; TACACACAGAACACTCACCGTAGTT
>probe:Drosophila_2:1635463_at:341:705; Interrogation_Position=502; Antisense; TTATGAATATTAAGCCGCGCGGAGG

Paste this into a BLAST search page for me
AAATCGTGCACGTTTATCCTCTGGTTATCCTCTGGTTAAGCACACCGATAAGAGGCCATTGAACTGTCCATTACCTACTCATCGAACTACGAGCACGCTGGAGCACGCTGCCAAAATCATCAAGGAGAAGTTCGGCATCTACTGGCATGTGTGATAGTCCTTCCAACATTCGTTGGAAGGGTTCGGCTTTGAGGTCTCCTAACATTCTTTATCTGTTCTTCGCCGATCGTGCTGTGGAAGTGCTCCTGAAAAGTGCTCCTGAATGCGGGTCAGCATTCGTTGGTGAATCGCAGACATGGCTACACACAGAACACTCACCGTAGTTTTATGAATATTAAGCCGCGCGGAGG

Full Affymetrix probeset data:

Annotations for 1635463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720