Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635466_at:

>probe:Drosophila_2:1635466_at:675:107; Interrogation_Position=1074; Antisense; AGAACGCGAGCAGGCGCAGCGCAAA
>probe:Drosophila_2:1635466_at:452:371; Interrogation_Position=603; Antisense; GAAGGACGATGACGTGTACCACTTT
>probe:Drosophila_2:1635466_at:695:599; Interrogation_Position=617; Antisense; TGTACCACTTTGTCGGCTATATGCC
>probe:Drosophila_2:1635466_at:119:681; Interrogation_Position=636; Antisense; TATGCCCATCGGAGGAAGACTGTAC
>probe:Drosophila_2:1635466_at:45:209; Interrogation_Position=651; Antisense; AAGACTGTACGAGCTGGACGGCCTG
>probe:Drosophila_2:1635466_at:126:435; Interrogation_Position=679; Antisense; GAGGGACCCATTGATCTTGGTGAGA
>probe:Drosophila_2:1635466_at:623:195; Interrogation_Position=718; Antisense; AACTGGATCGATGTGGTGCGTCCGA
>probe:Drosophila_2:1635466_at:110:239; Interrogation_Position=790; Antisense; AATCTGATGGCTCTGATCTCGGACA
>probe:Drosophila_2:1635466_at:30:39; Interrogation_Position=805; Antisense; ATCTCGGACAGGCAGCGCATTTATG
>probe:Drosophila_2:1635466_at:69:609; Interrogation_Position=840; Antisense; TGAGAAGCTGCTTAATCCGGCGCCC
>probe:Drosophila_2:1635466_at:483:575; Interrogation_Position=858; Antisense; GGCGCCCAATGCTATGGACACTGAG
>probe:Drosophila_2:1635466_at:322:551; Interrogation_Position=897; Antisense; GGAGATCAGTAGCTTGCGCACGTAC
>probe:Drosophila_2:1635466_at:36:361; Interrogation_Position=974; Antisense; GCAAGCACAACTATTTGCCCTTCAT
>probe:Drosophila_2:1635466_at:422:321; Interrogation_Position=990; Antisense; GCCCTTCATCGTGGAGCTCTTAAAA

Paste this into a BLAST search page for me
AGAACGCGAGCAGGCGCAGCGCAAAGAAGGACGATGACGTGTACCACTTTTGTACCACTTTGTCGGCTATATGCCTATGCCCATCGGAGGAAGACTGTACAAGACTGTACGAGCTGGACGGCCTGGAGGGACCCATTGATCTTGGTGAGAAACTGGATCGATGTGGTGCGTCCGAAATCTGATGGCTCTGATCTCGGACAATCTCGGACAGGCAGCGCATTTATGTGAGAAGCTGCTTAATCCGGCGCCCGGCGCCCAATGCTATGGACACTGAGGGAGATCAGTAGCTTGCGCACGTACGCAAGCACAACTATTTGCCCTTCATGCCCTTCATCGTGGAGCTCTTAAAA

Full Affymetrix probeset data:

Annotations for 1635466_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime