FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635469_at:

>probe:Drosophila_2:1635469_at:219:75; Interrogation_Position=159; Antisense; AGGACTTGTGTTTGCTGACTATGAC
>probe:Drosophila_2:1635469_at:595:543; Interrogation_Position=187; Antisense; GGACTTTACGGCCAGATTCAAACAG
>probe:Drosophila_2:1635469_at:151:189; Interrogation_Position=207; Antisense; AACAGGCCTGGTATACCTTATCTCT
>probe:Drosophila_2:1635469_at:276:675; Interrogation_Position=314; Antisense; TAGAACTCAGTGCTTGTGACCGCAT
>probe:Drosophila_2:1635469_at:723:593; Interrogation_Position=328; Antisense; TGTGACCGCATTCCCCGAGAAAAGT
>probe:Drosophila_2:1635469_at:79:483; Interrogation_Position=351; Antisense; GTATAGTTTCCTGCCGTTATTAAAG
>probe:Drosophila_2:1635469_at:312:211; Interrogation_Position=395; Antisense; AAGAACCCGTCGACGCAATTGGAAT
>probe:Drosophila_2:1635469_at:643:433; Interrogation_Position=452; Antisense; GAGGTTGCTTTATTCGGGAACTCTT
>probe:Drosophila_2:1635469_at:331:527; Interrogation_Position=467; Antisense; GGGAACTCTTACTTGTAGATCCTGA
>probe:Drosophila_2:1635469_at:101:677; Interrogation_Position=482; Antisense; TAGATCCTGATTTCCATCCTGTCAT
>probe:Drosophila_2:1635469_at:193:379; Interrogation_Position=526; Antisense; GAAGCCGTGAACTTTGTGGGTCAAC
>probe:Drosophila_2:1635469_at:562:329; Interrogation_Position=579; Antisense; GCGTGCCCAGCTTCACAATAATGAA
>probe:Drosophila_2:1635469_at:681:231; Interrogation_Position=603; Antisense; AATGAAGCTCAACGCCAGCTGGTAC
>probe:Drosophila_2:1635469_at:385:235; Interrogation_Position=643; Antisense; AATCCAGATATTCCTGACGCCACTG

Paste this into a BLAST search page for me
AGGACTTGTGTTTGCTGACTATGACGGACTTTACGGCCAGATTCAAACAGAACAGGCCTGGTATACCTTATCTCTTAGAACTCAGTGCTTGTGACCGCATTGTGACCGCATTCCCCGAGAAAAGTGTATAGTTTCCTGCCGTTATTAAAGAAGAACCCGTCGACGCAATTGGAATGAGGTTGCTTTATTCGGGAACTCTTGGGAACTCTTACTTGTAGATCCTGATAGATCCTGATTTCCATCCTGTCATGAAGCCGTGAACTTTGTGGGTCAACGCGTGCCCAGCTTCACAATAATGAAAATGAAGCTCAACGCCAGCTGGTACAATCCAGATATTCCTGACGCCACTG

Full Affymetrix probeset data:

Annotations for 1635469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720