FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635470_at:

>probe:Drosophila_2:1635470_at:480:237; Interrogation_Position=1017; Antisense; AATCTGGATTTGTATGGCGCCGCCG
>probe:Drosophila_2:1635470_at:483:55; Interrogation_Position=1054; Antisense; ATGAGCCGCTGCGATCGGTCAAGAA
>probe:Drosophila_2:1635470_at:702:321; Interrogation_Position=1120; Antisense; GCGATAGTTTCCACAATTACACCCT
>probe:Drosophila_2:1635470_at:335:229; Interrogation_Position=1147; Antisense; AATGGACACCCAGGGAACTTCGCTG
>probe:Drosophila_2:1635470_at:684:221; Interrogation_Position=1213; Antisense; AAGGGTCTTTCAGCGAGACGACTGC
>probe:Drosophila_2:1635470_at:610:557; Interrogation_Position=1242; Antisense; GGAAAGAGTTTACCGCAGGCCCAGA
>probe:Drosophila_2:1635470_at:152:77; Interrogation_Position=1303; Antisense; AGGAGTTCTACTTGACCTTCGGACT
>probe:Drosophila_2:1635470_at:523:639; Interrogation_Position=1321; Antisense; TCGGACTCAGCGTGGGCGGTTTTAA
>probe:Drosophila_2:1635470_at:178:431; Interrogation_Position=1347; Antisense; GAGTACCAGCACGAGATCAAACCCT
>probe:Drosophila_2:1635470_at:228:97; Interrogation_Position=1423; Antisense; AGATCAGGGACCACTGGCTGGACGA
>probe:Drosophila_2:1635470_at:308:523; Interrogation_Position=1448; Antisense; GGGCCACATGAAGATCGACTACGTA
>probe:Drosophila_2:1635470_at:555:531; Interrogation_Position=913; Antisense; GGGTGACTCCACAAATCTGGCTGCA
>probe:Drosophila_2:1635470_at:365:41; Interrogation_Position=970; Antisense; ATCGGTCGGGACAGCTGAGAATCGC
>probe:Drosophila_2:1635470_at:388:609; Interrogation_Position=985; Antisense; TGAGAATCGCTTATACCCGTCCGAA

Paste this into a BLAST search page for me
AATCTGGATTTGTATGGCGCCGCCGATGAGCCGCTGCGATCGGTCAAGAAGCGATAGTTTCCACAATTACACCCTAATGGACACCCAGGGAACTTCGCTGAAGGGTCTTTCAGCGAGACGACTGCGGAAAGAGTTTACCGCAGGCCCAGAAGGAGTTCTACTTGACCTTCGGACTTCGGACTCAGCGTGGGCGGTTTTAAGAGTACCAGCACGAGATCAAACCCTAGATCAGGGACCACTGGCTGGACGAGGGCCACATGAAGATCGACTACGTAGGGTGACTCCACAAATCTGGCTGCAATCGGTCGGGACAGCTGAGAATCGCTGAGAATCGCTTATACCCGTCCGAA

Full Affymetrix probeset data:

Annotations for 1635470_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720