FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635471_at:

>probe:Drosophila_2:1635471_at:367:401; Interrogation_Position=1344; Antisense; GACAGGAGATCTAAAATCGGCCATT
>probe:Drosophila_2:1635471_at:194:705; Interrogation_Position=1368; Antisense; TTATAAATACCAGCCACATCTCCTG
>probe:Drosophila_2:1635471_at:94:257; Interrogation_Position=1382; Antisense; CACATCTCCTGAATATCTCCGAGGG
>probe:Drosophila_2:1635471_at:699:529; Interrogation_Position=1406; Antisense; GGGATCTCAATGAACCGCGAAAATT
>probe:Drosophila_2:1635471_at:153:665; Interrogation_Position=1469; Antisense; TAAATGATATTACGCCGGGTCTCAA
>probe:Drosophila_2:1635471_at:158:469; Interrogation_Position=1498; Antisense; GTTGCGGCACTAAATCGTACGGATT
>probe:Drosophila_2:1635471_at:725:235; Interrogation_Position=1510; Antisense; AATCGTACGGATTATGCCTCAGGAC
>probe:Drosophila_2:1635471_at:258:277; Interrogation_Position=1647; Antisense; CTATGTCAAAGATCTACGCGTGGCT
>probe:Drosophila_2:1635471_at:491:135; Interrogation_Position=1662; Antisense; ACGCGTGGCTGGTAATATTTGTGCA
>probe:Drosophila_2:1635471_at:658:507; Interrogation_Position=1682; Antisense; GTGCAGAAGTGCGTCCCAATTTGAG
>probe:Drosophila_2:1635471_at:385:27; Interrogation_Position=1715; Antisense; ATAGCTTTTGCCACAGCCTAGGAGG
>probe:Drosophila_2:1635471_at:396:77; Interrogation_Position=1734; Antisense; AGGAGGTCGGCAAAGTTGGCATTAT
>probe:Drosophila_2:1635471_at:643:21; Interrogation_Position=1820; Antisense; ATATTTTTCTGGCTATTTGCGACGC
>probe:Drosophila_2:1635471_at:161:721; Interrogation_Position=1836; Antisense; TTGCGACGCCGCGAACGGAAAACAA

Paste this into a BLAST search page for me
GACAGGAGATCTAAAATCGGCCATTTTATAAATACCAGCCACATCTCCTGCACATCTCCTGAATATCTCCGAGGGGGGATCTCAATGAACCGCGAAAATTTAAATGATATTACGCCGGGTCTCAAGTTGCGGCACTAAATCGTACGGATTAATCGTACGGATTATGCCTCAGGACCTATGTCAAAGATCTACGCGTGGCTACGCGTGGCTGGTAATATTTGTGCAGTGCAGAAGTGCGTCCCAATTTGAGATAGCTTTTGCCACAGCCTAGGAGGAGGAGGTCGGCAAAGTTGGCATTATATATTTTTCTGGCTATTTGCGACGCTTGCGACGCCGCGAACGGAAAACAA

Full Affymetrix probeset data:

Annotations for 1635471_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720