FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635473_at:

>probe:Drosophila_2:1635473_at:714:267; Interrogation_Position=115; Antisense; CATGTGGACCCAGGCGAGGATGATT
>probe:Drosophila_2:1635473_at:153:327; Interrogation_Position=128; Antisense; GCGAGGATGATTTTACCACTGCCCT
>probe:Drosophila_2:1635473_at:543:671; Interrogation_Position=141; Antisense; TACCACTGCCCTGCGAGAAACGAAA
>probe:Drosophila_2:1635473_at:421:451; Interrogation_Position=199; Antisense; GATCATATACAAGGACACTCCGCTG
>probe:Drosophila_2:1635473_at:150:145; Interrogation_Position=215; Antisense; ACTCCGCTGACCCTGAATTATCAGG
>probe:Drosophila_2:1635473_at:85:693; Interrogation_Position=25; Antisense; TTTGTTATTTTTCGCCGCCTTTGTG
>probe:Drosophila_2:1635473_at:685:3; Interrogation_Position=257; Antisense; ATTGTTATTTACTGGCTAGCGGAGC
>probe:Drosophila_2:1635473_at:482:121; Interrogation_Position=274; Antisense; AGCGGAGCTGCGGAATCCCTGCCAG
>probe:Drosophila_2:1635473_at:279:553; Interrogation_Position=316; Antisense; GGAGCACACCGACCTCAAGTGGCTG
>probe:Drosophila_2:1635473_at:327:439; Interrogation_Position=350; Antisense; GAGGCCAAGCAGTGCGTCGGCTTTA
>probe:Drosophila_2:1635473_at:379:505; Interrogation_Position=361; Antisense; GTGCGTCGGCTTTAAGGATAACCAA
>probe:Drosophila_2:1635473_at:232:497; Interrogation_Position=386; Antisense; GTCATGATCGACAAGTTCCACCAAA
>probe:Drosophila_2:1635473_at:3:27; Interrogation_Position=60; Antisense; ATACCTATTGCTGAAGGCTTCCTAC
>probe:Drosophila_2:1635473_at:560:309; Interrogation_Position=92; Antisense; TCCACTGGAGTTCTCCCAAGGGACA

Paste this into a BLAST search page for me
CATGTGGACCCAGGCGAGGATGATTGCGAGGATGATTTTACCACTGCCCTTACCACTGCCCTGCGAGAAACGAAAGATCATATACAAGGACACTCCGCTGACTCCGCTGACCCTGAATTATCAGGTTTGTTATTTTTCGCCGCCTTTGTGATTGTTATTTACTGGCTAGCGGAGCAGCGGAGCTGCGGAATCCCTGCCAGGGAGCACACCGACCTCAAGTGGCTGGAGGCCAAGCAGTGCGTCGGCTTTAGTGCGTCGGCTTTAAGGATAACCAAGTCATGATCGACAAGTTCCACCAAAATACCTATTGCTGAAGGCTTCCTACTCCACTGGAGTTCTCCCAAGGGACA

Full Affymetrix probeset data:

Annotations for 1635473_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720