FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635474_at:

>probe:Drosophila_2:1635474_at:470:723; Interrogation_Position=1012; Antisense; TTGAACGACTTCTATCCCAGCGATT
>probe:Drosophila_2:1635474_at:259:49; Interrogation_Position=1030; Antisense; AGCGATTTCCTTGTTTACTAGCCCA
>probe:Drosophila_2:1635474_at:233:525; Interrogation_Position=1196; Antisense; GGGCTACATGCCAACTGTGCAACAT
>probe:Drosophila_2:1635474_at:525:299; Interrogation_Position=1224; Antisense; CGCCTGTTCCTGCAGGTTTGAGATT
>probe:Drosophila_2:1635474_at:628:427; Interrogation_Position=1243; Antisense; GAGATTAATTCTGATTCCGGGCCAA
>probe:Drosophila_2:1635474_at:513:463; Interrogation_Position=1255; Antisense; GATTCCGGGCCAATATTACCAATGT
>probe:Drosophila_2:1635474_at:10:571; Interrogation_Position=1288; Antisense; GGCTTTCGAGGCTATCCAATACTTT
>probe:Drosophila_2:1635474_at:81:51; Interrogation_Position=1325; Antisense; ATGCCTCAGCATGGGACGCTTTAAT
>probe:Drosophila_2:1635474_at:317:29; Interrogation_Position=1407; Antisense; ATACTAACTTATTCATCTCTCTCTC
>probe:Drosophila_2:1635474_at:594:401; Interrogation_Position=853; Antisense; GACTATGGCGTGCACGCTTTGACAG
>probe:Drosophila_2:1635474_at:99:155; Interrogation_Position=874; Antisense; ACAGTGCACTGTTTGCGGCTACGGA
>probe:Drosophila_2:1635474_at:522:669; Interrogation_Position=893; Antisense; TACGGACCTTGCTCATTCGACGTTG
>probe:Drosophila_2:1635474_at:616:327; Interrogation_Position=960; Antisense; GCGTCTTTACATCGATAGGCCACAG
>probe:Drosophila_2:1635474_at:91:525; Interrogation_Position=994; Antisense; GGGCTCAACGCTTACAACTTGAACG

Paste this into a BLAST search page for me
TTGAACGACTTCTATCCCAGCGATTAGCGATTTCCTTGTTTACTAGCCCAGGGCTACATGCCAACTGTGCAACATCGCCTGTTCCTGCAGGTTTGAGATTGAGATTAATTCTGATTCCGGGCCAAGATTCCGGGCCAATATTACCAATGTGGCTTTCGAGGCTATCCAATACTTTATGCCTCAGCATGGGACGCTTTAATATACTAACTTATTCATCTCTCTCTCGACTATGGCGTGCACGCTTTGACAGACAGTGCACTGTTTGCGGCTACGGATACGGACCTTGCTCATTCGACGTTGGCGTCTTTACATCGATAGGCCACAGGGGCTCAACGCTTACAACTTGAACG

Full Affymetrix probeset data:

Annotations for 1635474_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720