FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635476_at:

>probe:Drosophila_2:1635476_at:285:243; Interrogation_Position=1027; Antisense; AATATCTGTGGGACTACCGGCGTCG
>probe:Drosophila_2:1635476_at:363:535; Interrogation_Position=1088; Antisense; GGTGCTGAGCATCTACTACTAACGA
>probe:Drosophila_2:1635476_at:179:165; Interrogation_Position=606; Antisense; AAATCGGCAGTTCGCTTGCTGGATC
>probe:Drosophila_2:1635476_at:705:451; Interrogation_Position=627; Antisense; GATCTCGTTGTGGAGGAGTTTCCCT
>probe:Drosophila_2:1635476_at:60:551; Interrogation_Position=641; Antisense; GGAGTTTCCCTGTTTTCGCGATGAG
>probe:Drosophila_2:1635476_at:662:427; Interrogation_Position=685; Antisense; GAGTTTCCATCCTAAAACGAGCGCA
>probe:Drosophila_2:1635476_at:236:47; Interrogation_Position=711; Antisense; ATCCTAGTGGGCGATGTGTGGTCCT
>probe:Drosophila_2:1635476_at:704:61; Interrogation_Position=724; Antisense; ATGTGTGGTCCTGCTACAGAGGTCA
>probe:Drosophila_2:1635476_at:138:267; Interrogation_Position=747; Antisense; CAGGGACTTGGGTTCTTTAATGACA
>probe:Drosophila_2:1635476_at:322:95; Interrogation_Position=778; Antisense; AGATAACCATGTTCGCTGACTACCG
>probe:Drosophila_2:1635476_at:428:619; Interrogation_Position=814; Antisense; TGCTAGTGCACTTCGGCAGTTTGGA
>probe:Drosophila_2:1635476_at:549:671; Interrogation_Position=913; Antisense; TACGCGGCGCATCTATATACATCAT
>probe:Drosophila_2:1635476_at:463:27; Interrogation_Position=966; Antisense; ATACTCAAGGAGCAGCACCCCGAAA
>probe:Drosophila_2:1635476_at:531:301; Interrogation_Position=985; Antisense; CCGAAATCTCACTGGACAACGTCAA

Paste this into a BLAST search page for me
AATATCTGTGGGACTACCGGCGTCGGGTGCTGAGCATCTACTACTAACGAAAATCGGCAGTTCGCTTGCTGGATCGATCTCGTTGTGGAGGAGTTTCCCTGGAGTTTCCCTGTTTTCGCGATGAGGAGTTTCCATCCTAAAACGAGCGCAATCCTAGTGGGCGATGTGTGGTCCTATGTGTGGTCCTGCTACAGAGGTCACAGGGACTTGGGTTCTTTAATGACAAGATAACCATGTTCGCTGACTACCGTGCTAGTGCACTTCGGCAGTTTGGATACGCGGCGCATCTATATACATCATATACTCAAGGAGCAGCACCCCGAAACCGAAATCTCACTGGACAACGTCAA

Full Affymetrix probeset data:

Annotations for 1635476_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720