FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635482_at:

>probe:Drosophila_2:1635482_at:210:351; Interrogation_Position=1017; Antisense; GCAGTATGTGGCCAACCATCTGAAG
>probe:Drosophila_2:1635482_at:698:479; Interrogation_Position=1068; Antisense; GTAGCAGCAGTTGTCCAGGTTACAA
>probe:Drosophila_2:1635482_at:207:579; Interrogation_Position=558; Antisense; GGCCATTCGCAGCTTTAATCTCTAT
>probe:Drosophila_2:1635482_at:424:385; Interrogation_Position=589; Antisense; GAACTTAGCTTTGTGGATCGTCTCA
>probe:Drosophila_2:1635482_at:715:543; Interrogation_Position=621; Antisense; GGATCAGCGCAACAATTCGGCCTGG
>probe:Drosophila_2:1635482_at:577:379; Interrogation_Position=645; Antisense; GAACCAGCGCTTCTTTGTGATCAAG
>probe:Drosophila_2:1635482_at:51:209; Interrogation_Position=667; Antisense; AAGCATTTTGGATTCACGCCGGAGC
>probe:Drosophila_2:1635482_at:369:261; Interrogation_Position=697; Antisense; CAGCGCGAACTGTCGTACACGATGA
>probe:Drosophila_2:1635482_at:659:367; Interrogation_Position=720; Antisense; GAATCGCATTCGCATCATCAAAAAC
>probe:Drosophila_2:1635482_at:544:83; Interrogation_Position=793; Antisense; AGTGGAAATGCCCTGCTGAGCAGCT
>probe:Drosophila_2:1635482_at:639:113; Interrogation_Position=811; Antisense; AGCAGCTACCCGGATGTCGTGGACT
>probe:Drosophila_2:1635482_at:232:639; Interrogation_Position=827; Antisense; TCGTGGACTTTGTGGAGGAGCTCTA
>probe:Drosophila_2:1635482_at:349:169; Interrogation_Position=924; Antisense; AAAGGCCAGCGATAGCGATCAACTC
>probe:Drosophila_2:1635482_at:118:559; Interrogation_Position=975; Antisense; GGACATGGCCACCAAACACGATGTG

Paste this into a BLAST search page for me
GCAGTATGTGGCCAACCATCTGAAGGTAGCAGCAGTTGTCCAGGTTACAAGGCCATTCGCAGCTTTAATCTCTATGAACTTAGCTTTGTGGATCGTCTCAGGATCAGCGCAACAATTCGGCCTGGGAACCAGCGCTTCTTTGTGATCAAGAAGCATTTTGGATTCACGCCGGAGCCAGCGCGAACTGTCGTACACGATGAGAATCGCATTCGCATCATCAAAAACAGTGGAAATGCCCTGCTGAGCAGCTAGCAGCTACCCGGATGTCGTGGACTTCGTGGACTTTGTGGAGGAGCTCTAAAAGGCCAGCGATAGCGATCAACTCGGACATGGCCACCAAACACGATGTG

Full Affymetrix probeset data:

Annotations for 1635482_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720