FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635483_at:

>probe:Drosophila_2:1635483_at:162:417; Interrogation_Position=1010; Antisense; GAGCCGAAGGATATCTAGCAACATT
>probe:Drosophila_2:1635483_at:203:191; Interrogation_Position=1029; Antisense; AACATTTTCAATTATCTTCCCCACT
>probe:Drosophila_2:1635483_at:207:719; Interrogation_Position=1071; Antisense; TTCCTTTCCAAAACCGAGCGCAGAA
>probe:Drosophila_2:1635483_at:148:629; Interrogation_Position=1137; Antisense; TGCCACACTCTCTGTAGCTGATAAG
>probe:Drosophila_2:1635483_at:436:163; Interrogation_Position=1195; Antisense; AAATTATTTCCAATCCAGCCATCCA
>probe:Drosophila_2:1635483_at:427:563; Interrogation_Position=1222; Antisense; GGAAGCCATTGTGCTGGGCCAAGAA
>probe:Drosophila_2:1635483_at:507:521; Interrogation_Position=1237; Antisense; GGGCCAAGAACTCCAGGTTTAGGAT
>probe:Drosophila_2:1635483_at:719:337; Interrogation_Position=1270; Antisense; GCTAACTGTTTGTAAATTTCGCCAT
>probe:Drosophila_2:1635483_at:634:383; Interrogation_Position=1299; Antisense; GAACAGTTTAGCTGGCCAAGTTTAT
>probe:Drosophila_2:1635483_at:619:35; Interrogation_Position=1322; Antisense; ATCAGTGAAAGGTTTCGGCGCACAA
>probe:Drosophila_2:1635483_at:638:113; Interrogation_Position=879; Antisense; AGCAGCTACCCTGTTAGCGCCATTG
>probe:Drosophila_2:1635483_at:4:297; Interrogation_Position=926; Antisense; CGACCACCATGGTTACCACAAGTAA
>probe:Drosophila_2:1635483_at:44:587; Interrogation_Position=961; Antisense; TGGACCGGAAGCAGGCGAATCTATT
>probe:Drosophila_2:1635483_at:356:365; Interrogation_Position=977; Antisense; GAATCTATTGGAGCGAGCGGACTTA

Paste this into a BLAST search page for me
GAGCCGAAGGATATCTAGCAACATTAACATTTTCAATTATCTTCCCCACTTTCCTTTCCAAAACCGAGCGCAGAATGCCACACTCTCTGTAGCTGATAAGAAATTATTTCCAATCCAGCCATCCAGGAAGCCATTGTGCTGGGCCAAGAAGGGCCAAGAACTCCAGGTTTAGGATGCTAACTGTTTGTAAATTTCGCCATGAACAGTTTAGCTGGCCAAGTTTATATCAGTGAAAGGTTTCGGCGCACAAAGCAGCTACCCTGTTAGCGCCATTGCGACCACCATGGTTACCACAAGTAATGGACCGGAAGCAGGCGAATCTATTGAATCTATTGGAGCGAGCGGACTTA

Full Affymetrix probeset data:

Annotations for 1635483_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720