Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635486_at:

>probe:Drosophila_2:1635486_at:582:167; Interrogation_Position=120; Antisense; AAATGAGTACATTCCAACCGAAGTG
>probe:Drosophila_2:1635486_at:257:479; Interrogation_Position=164; Antisense; GTTTAAGCGATGTTCGAGCGCCTCG
>probe:Drosophila_2:1635486_at:324:415; Interrogation_Position=179; Antisense; GAGCGCCTCGCCGAAAACTGTGGTA
>probe:Drosophila_2:1635486_at:101:191; Interrogation_Position=18; Antisense; AACATCTGCTGTTGAAGCTCCCAAT
>probe:Drosophila_2:1635486_at:458:519; Interrogation_Position=198; Antisense; GTGGTACATGTACTATGCGACAACA
>probe:Drosophila_2:1635486_at:544:51; Interrogation_Position=212; Antisense; ATGCGACAACAGATCAGGTGGACAA
>probe:Drosophila_2:1635486_at:256:293; Interrogation_Position=282; Antisense; CGAGCTGTTCAGAAAACCGGTATAT
>probe:Drosophila_2:1635486_at:676:523; Interrogation_Position=311; Antisense; GGGCTGGAATGCGATCCCGTGTTAA
>probe:Drosophila_2:1635486_at:44:327; Interrogation_Position=321; Antisense; GCGATCCCGTGTTAAGAACCACTTT
>probe:Drosophila_2:1635486_at:258:119; Interrogation_Position=33; Antisense; AGCTCCCAATAGTGCATATCCCGAT
>probe:Drosophila_2:1635486_at:130:561; Interrogation_Position=370; Antisense; GGAAACATTTTGGAAGCCCCGCTAG
>probe:Drosophila_2:1635486_at:424:303; Interrogation_Position=388; Antisense; CCGCTAGGTAGCTCCCTTAATGATG
>probe:Drosophila_2:1635486_at:215:457; Interrogation_Position=461; Antisense; GATACTTCGATTACCTTATGTCTAG
>probe:Drosophila_2:1635486_at:610:17; Interrogation_Position=80; Antisense; ATTTGCGAAGTGTGTTTTGCCTAAA

Paste this into a BLAST search page for me
AAATGAGTACATTCCAACCGAAGTGGTTTAAGCGATGTTCGAGCGCCTCGGAGCGCCTCGCCGAAAACTGTGGTAAACATCTGCTGTTGAAGCTCCCAATGTGGTACATGTACTATGCGACAACAATGCGACAACAGATCAGGTGGACAACGAGCTGTTCAGAAAACCGGTATATGGGCTGGAATGCGATCCCGTGTTAAGCGATCCCGTGTTAAGAACCACTTTAGCTCCCAATAGTGCATATCCCGATGGAAACATTTTGGAAGCCCCGCTAGCCGCTAGGTAGCTCCCTTAATGATGGATACTTCGATTACCTTATGTCTAGATTTGCGAAGTGTGTTTTGCCTAAA

Full Affymetrix probeset data:

Annotations for 1635486_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime