FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635487_at:

>probe:Drosophila_2:1635487_at:241:99; Interrogation_Position=1426; Antisense; AGATGCTGCATCACCGGGCTGTGGC
>probe:Drosophila_2:1635487_at:343:573; Interrogation_Position=1442; Antisense; GGCTGTGGCTGAAGACCTTGGCTAC
>probe:Drosophila_2:1635487_at:14:3; Interrogation_Position=1458; Antisense; CTTGGCTACAAATTCGGACCCGAGA
>probe:Drosophila_2:1635487_at:665:233; Interrogation_Position=1487; Antisense; AATCCTTGTCACAGGAGGCGCATCT
>probe:Drosophila_2:1635487_at:697:7; Interrogation_Position=1536; Antisense; ATTGCCGATGTGTTCAATGCTCCCG
>probe:Drosophila_2:1635487_at:686:335; Interrogation_Position=1554; Antisense; GCTCCCGTCCATATCCAGGATGAAG
>probe:Drosophila_2:1635487_at:143:55; Interrogation_Position=1573; Antisense; ATGAAGGATTTGAGGCTGCCCTACT
>probe:Drosophila_2:1635487_at:582:671; Interrogation_Position=1620; Antisense; TACGCTCTGTACCTTCAAGAGGCAG
>probe:Drosophila_2:1635487_at:251:411; Interrogation_Position=1655; Antisense; GACGCCTCTCTGTTACCGAGATTAT
>probe:Drosophila_2:1635487_at:242:195; Interrogation_Position=1702; Antisense; AACTGAGCCTTGTATGCGAACCACA
>probe:Drosophila_2:1635487_at:615:559; Interrogation_Position=1739; Antisense; GGAAATCTACGCTCCAATGCTACAA
>probe:Drosophila_2:1635487_at:229:505; Interrogation_Position=1785; Antisense; GTCCTGTCCAATCCTAACACATAAA
>probe:Drosophila_2:1635487_at:237:393; Interrogation_Position=1816; Antisense; GAAAGCCCAACGTAACATTCCAGTT
>probe:Drosophila_2:1635487_at:530:463; Interrogation_Position=1864; Antisense; GATTCCTTCTTAAACGTCTCCTGTA

Paste this into a BLAST search page for me
AGATGCTGCATCACCGGGCTGTGGCGGCTGTGGCTGAAGACCTTGGCTACCTTGGCTACAAATTCGGACCCGAGAAATCCTTGTCACAGGAGGCGCATCTATTGCCGATGTGTTCAATGCTCCCGGCTCCCGTCCATATCCAGGATGAAGATGAAGGATTTGAGGCTGCCCTACTTACGCTCTGTACCTTCAAGAGGCAGGACGCCTCTCTGTTACCGAGATTATAACTGAGCCTTGTATGCGAACCACAGGAAATCTACGCTCCAATGCTACAAGTCCTGTCCAATCCTAACACATAAAGAAAGCCCAACGTAACATTCCAGTTGATTCCTTCTTAAACGTCTCCTGTA

Full Affymetrix probeset data:

Annotations for 1635487_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720