FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635488_at:

>probe:Drosophila_2:1635488_at:28:27; Interrogation_Position=3050; Antisense; ATACGCGCCGAACTCAAAAGACTGT
>probe:Drosophila_2:1635488_at:150:269; Interrogation_Position=3113; Antisense; CAGGACAATCCGCACATCAGTAAGC
>probe:Drosophila_2:1635488_at:163:351; Interrogation_Position=3178; Antisense; GCAGATAGCACCACATAAGTCTTAT
>probe:Drosophila_2:1635488_at:562:181; Interrogation_Position=3235; Antisense; AAAACACATATCCACCAGTTGTCCA
>probe:Drosophila_2:1635488_at:367:265; Interrogation_Position=3250; Antisense; CAGTTGTCCATGTGACCCACTAAAA
>probe:Drosophila_2:1635488_at:229:163; Interrogation_Position=3281; Antisense; AAATTCGCAGGCTCTAAGTGCCAAA
>probe:Drosophila_2:1635488_at:283:359; Interrogation_Position=3313; Antisense; GCAACAAGCATCATCAGGACATCGA
>probe:Drosophila_2:1635488_at:18:561; Interrogation_Position=3350; Antisense; GGAACCTTCCAGGACGCCCGAGGAT
>probe:Drosophila_2:1635488_at:108:595; Interrogation_Position=3379; Antisense; TGTGCAGTGCCGAAGGACCCACGGA
>probe:Drosophila_2:1635488_at:1:413; Interrogation_Position=3394; Antisense; GACCCACGGATACCTATGCGGAAAT
>probe:Drosophila_2:1635488_at:36:53; Interrogation_Position=3409; Antisense; ATGCGGAAATCTCCGGCGTGTCCCA
>probe:Drosophila_2:1635488_at:549:653; Interrogation_Position=3435; Antisense; TCAATGCTCTCTCACTCGATGGTCT
>probe:Drosophila_2:1635488_at:154:145; Interrogation_Position=3463; Antisense; ACTCCGTGGTCTCGCATTCGAAGTA
>probe:Drosophila_2:1635488_at:384:677; Interrogation_Position=3486; Antisense; TAGGGAGTCCTTGCTGGTTCATGGC

Paste this into a BLAST search page for me
ATACGCGCCGAACTCAAAAGACTGTCAGGACAATCCGCACATCAGTAAGCGCAGATAGCACCACATAAGTCTTATAAAACACATATCCACCAGTTGTCCACAGTTGTCCATGTGACCCACTAAAAAAATTCGCAGGCTCTAAGTGCCAAAGCAACAAGCATCATCAGGACATCGAGGAACCTTCCAGGACGCCCGAGGATTGTGCAGTGCCGAAGGACCCACGGAGACCCACGGATACCTATGCGGAAATATGCGGAAATCTCCGGCGTGTCCCATCAATGCTCTCTCACTCGATGGTCTACTCCGTGGTCTCGCATTCGAAGTATAGGGAGTCCTTGCTGGTTCATGGC

Full Affymetrix probeset data:

Annotations for 1635488_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720