Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635492_at:

>probe:Drosophila_2:1635492_at:429:561; Interrogation_Position=103; Antisense; GGAACTCAAACGGATTGCCCCACAG
>probe:Drosophila_2:1635492_at:721:343; Interrogation_Position=127; Antisense; GCTTGTCCAGAAACGTGTGATACCA
>probe:Drosophila_2:1635492_at:396:211; Interrogation_Position=152; Antisense; AAGGAAAGCCCAATTGTACTTTGAT
>probe:Drosophila_2:1635492_at:517:489; Interrogation_Position=167; Antisense; GTACTTTGATATGCGGAGGTCCTTG
>probe:Drosophila_2:1635492_at:169:435; Interrogation_Position=182; Antisense; GAGGTCCTTGTGTCTGCAAGCCAGG
>probe:Drosophila_2:1635492_at:540:283; Interrogation_Position=195; Antisense; CTGCAAGCCAGGATATGTTGTCAAT
>probe:Drosophila_2:1635492_at:466:675; Interrogation_Position=219; Antisense; TAGAATGATTCCTGCCTGTGTACTG
>probe:Drosophila_2:1635492_at:442:515; Interrogation_Position=236; Antisense; GTGTACTGCGATCTGATTGTCCAAA
>probe:Drosophila_2:1635492_at:229:561; Interrogation_Position=24; Antisense; GGAAACATTCACTCTTGTGGTACTG
>probe:Drosophila_2:1635492_at:607:481; Interrogation_Position=265; Antisense; GTATTACAAAGCGACAGAGCCCGAA
>probe:Drosophila_2:1635492_at:416:413; Interrogation_Position=281; Antisense; GAGCCCGAAGACTGACGAATTTCAA
>probe:Drosophila_2:1635492_at:372:527; Interrogation_Position=317; Antisense; GGGAAAATACTTGCACTCAACTAAA
>probe:Drosophila_2:1635492_at:389:583; Interrogation_Position=41; Antisense; TGGTACTGTGTAGTTTTTCGGCGGT
>probe:Drosophila_2:1635492_at:219:699; Interrogation_Position=54; Antisense; TTTTTCGGCGGTAAAGTGCTTTGCT

Paste this into a BLAST search page for me
GGAACTCAAACGGATTGCCCCACAGGCTTGTCCAGAAACGTGTGATACCAAAGGAAAGCCCAATTGTACTTTGATGTACTTTGATATGCGGAGGTCCTTGGAGGTCCTTGTGTCTGCAAGCCAGGCTGCAAGCCAGGATATGTTGTCAATTAGAATGATTCCTGCCTGTGTACTGGTGTACTGCGATCTGATTGTCCAAAGGAAACATTCACTCTTGTGGTACTGGTATTACAAAGCGACAGAGCCCGAAGAGCCCGAAGACTGACGAATTTCAAGGGAAAATACTTGCACTCAACTAAATGGTACTGTGTAGTTTTTCGGCGGTTTTTTCGGCGGTAAAGTGCTTTGCT

Full Affymetrix probeset data:

Annotations for 1635492_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime