Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635498_at:

>probe:Drosophila_2:1635498_at:462:459; Interrogation_Position=1006; Antisense; GATATAGCGCGTTTTATTCCAGAAC
>probe:Drosophila_2:1635498_at:182:155; Interrogation_Position=1029; Antisense; ACAGACTTTCTATGAATCCGTGCAA
>probe:Drosophila_2:1635498_at:453:169; Interrogation_Position=1053; Antisense; AAAGTTTCGAAGTGTTGGCCTGATC
>probe:Drosophila_2:1635498_at:684:171; Interrogation_Position=1079; Antisense; AAAGCTGTTTGTTCTGTCACCTGGT
>probe:Drosophila_2:1635498_at:455:195; Interrogation_Position=1130; Antisense; AACTGACCAGTTCTGTGGATGGCTT
>probe:Drosophila_2:1635498_at:407:439; Interrogation_Position=1147; Antisense; GATGGCTTTAACGACTTTTTCACTA
>probe:Drosophila_2:1635498_at:588:427; Interrogation_Position=1183; Antisense; GAGATTTGCCTGGAGGCCTTCAACA
>probe:Drosophila_2:1635498_at:75:63; Interrogation_Position=718; Antisense; ATGTCCTTTATTTTTGAGGCCGTCA
>probe:Drosophila_2:1635498_at:206:495; Interrogation_Position=739; Antisense; GTCAAGACCTCGGATGTGTACCAGA
>probe:Drosophila_2:1635498_at:639:23; Interrogation_Position=819; Antisense; ATATGGCGAGGTTCCACTGCAGTGC
>probe:Drosophila_2:1635498_at:483:273; Interrogation_Position=847; Antisense; CTTGTGGACTTCCAGTTGGCCAGAT
>probe:Drosophila_2:1635498_at:147:171; Interrogation_Position=922; Antisense; AAAGAGTTCAGGGACGCCCATCTCA
>probe:Drosophila_2:1635498_at:526:571; Interrogation_Position=957; Antisense; GGCGGAATACTACCGGTTCATGACC
>probe:Drosophila_2:1635498_at:119:473; Interrogation_Position=972; Antisense; GTTCATGACCGAGTTCCTGAAGCGT

Paste this into a BLAST search page for me
GATATAGCGCGTTTTATTCCAGAACACAGACTTTCTATGAATCCGTGCAAAAAGTTTCGAAGTGTTGGCCTGATCAAAGCTGTTTGTTCTGTCACCTGGTAACTGACCAGTTCTGTGGATGGCTTGATGGCTTTAACGACTTTTTCACTAGAGATTTGCCTGGAGGCCTTCAACAATGTCCTTTATTTTTGAGGCCGTCAGTCAAGACCTCGGATGTGTACCAGAATATGGCGAGGTTCCACTGCAGTGCCTTGTGGACTTCCAGTTGGCCAGATAAAGAGTTCAGGGACGCCCATCTCAGGCGGAATACTACCGGTTCATGACCGTTCATGACCGAGTTCCTGAAGCGT

Full Affymetrix probeset data:

Annotations for 1635498_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime