FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635501_at:

>probe:Drosophila_2:1635501_at:350:503; Interrogation_Position=1912; Antisense; GTCGCCACAGCACTACGCAATTTAG
>probe:Drosophila_2:1635501_at:652:669; Interrogation_Position=1972; Antisense; TACGCAATGCGTGACTTAGTTCAGA
>probe:Drosophila_2:1635501_at:704:675; Interrogation_Position=1988; Antisense; TAGTTCAGAAACTTCCATCCGGAAA
>probe:Drosophila_2:1635501_at:293:695; Interrogation_Position=2099; Antisense; TTTCCCGTTCCCTATTGGATTCAGG
>probe:Drosophila_2:1635501_at:42:27; Interrogation_Position=2168; Antisense; ATACCTCTTGTGTGTTGAAATTTGC
>probe:Drosophila_2:1635501_at:320:89; Interrogation_Position=2194; Antisense; AGTCAAGTTTTATACACCATGTGGC
>probe:Drosophila_2:1635501_at:512:707; Interrogation_Position=2288; Antisense; TTACTGCACATAATACTCCACCAAG
>probe:Drosophila_2:1635501_at:518:677; Interrogation_Position=2343; Antisense; TAGACCGATGGCTTCACAGGGACGT
>probe:Drosophila_2:1635501_at:247:153; Interrogation_Position=2358; Antisense; ACAGGGACGTACTCGCTATGAGGAC
>probe:Drosophila_2:1635501_at:19:439; Interrogation_Position=2377; Antisense; GAGGACAGAACCATTCAACGCGGAA
>probe:Drosophila_2:1635501_at:375:199; Interrogation_Position=2393; Antisense; AACGCGGAACAAGCACATTATATAG
>probe:Drosophila_2:1635501_at:570:675; Interrogation_Position=2415; Antisense; TAGTGCTAACGATTCCAGTGGTGCC
>probe:Drosophila_2:1635501_at:656:307; Interrogation_Position=2429; Antisense; CCAGTGGTGCCGTTATGTCTAATGA
>probe:Drosophila_2:1635501_at:460:61; Interrogation_Position=2443; Antisense; ATGTCTAATGAATCTGCAATGCTTT

Paste this into a BLAST search page for me
GTCGCCACAGCACTACGCAATTTAGTACGCAATGCGTGACTTAGTTCAGATAGTTCAGAAACTTCCATCCGGAAATTTCCCGTTCCCTATTGGATTCAGGATACCTCTTGTGTGTTGAAATTTGCAGTCAAGTTTTATACACCATGTGGCTTACTGCACATAATACTCCACCAAGTAGACCGATGGCTTCACAGGGACGTACAGGGACGTACTCGCTATGAGGACGAGGACAGAACCATTCAACGCGGAAAACGCGGAACAAGCACATTATATAGTAGTGCTAACGATTCCAGTGGTGCCCCAGTGGTGCCGTTATGTCTAATGAATGTCTAATGAATCTGCAATGCTTT

Full Affymetrix probeset data:

Annotations for 1635501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720