FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635502_at:

>probe:Drosophila_2:1635502_at:299:21; Interrogation_Position=1297; Antisense; ATTTGGATGACACCATGTCCGTGCT
>probe:Drosophila_2:1635502_at:649:61; Interrogation_Position=1311; Antisense; ATGTCCGTGCTCTGGCGACAATACT
>probe:Drosophila_2:1635502_at:489:241; Interrogation_Position=1330; Antisense; AATACTCTGGCCTTGCTATCGGGAA
>probe:Drosophila_2:1635502_at:723:683; Interrogation_Position=1346; Antisense; TATCGGGAATTCTAGCTGTCGGCGT
>probe:Drosophila_2:1635502_at:109:145; Interrogation_Position=1378; Antisense; ACTGCAGCCAGTGTAGTGGGATCCA
>probe:Drosophila_2:1635502_at:427:7; Interrogation_Position=1453; Antisense; ATTGCGTTCGTGGTGTCCATTCTCA
>probe:Drosophila_2:1635502_at:329:57; Interrogation_Position=1516; Antisense; ATGAGCCAGGCCAAGTGGTTCGCCA
>probe:Drosophila_2:1635502_at:702:15; Interrogation_Position=1543; Antisense; ATTTTCGCAGCACTGAATTCGGCTC
>probe:Drosophila_2:1635502_at:691:11; Interrogation_Position=1559; Antisense; ATTCGGCTCTGGTGGAGGCGTTCAC
>probe:Drosophila_2:1635502_at:187:287; Interrogation_Position=1600; Antisense; CTGGTACTACCCCTGATATTCTATA
>probe:Drosophila_2:1635502_at:403:21; Interrogation_Position=1615; Antisense; ATATTCTATACCATTGTGGGCCTGG
>probe:Drosophila_2:1635502_at:125:517; Interrogation_Position=1630; Antisense; GTGGGCCTGGCCTAAATAGAATGCA
>probe:Drosophila_2:1635502_at:602:487; Interrogation_Position=1678; Antisense; GTACGCATTCCTCGGTGTATTTATA
>probe:Drosophila_2:1635502_at:153:25; Interrogation_Position=1803; Antisense; ATATGCTACCTTTCTAATCCAACAC

Paste this into a BLAST search page for me
ATTTGGATGACACCATGTCCGTGCTATGTCCGTGCTCTGGCGACAATACTAATACTCTGGCCTTGCTATCGGGAATATCGGGAATTCTAGCTGTCGGCGTACTGCAGCCAGTGTAGTGGGATCCAATTGCGTTCGTGGTGTCCATTCTCAATGAGCCAGGCCAAGTGGTTCGCCAATTTTCGCAGCACTGAATTCGGCTCATTCGGCTCTGGTGGAGGCGTTCACCTGGTACTACCCCTGATATTCTATAATATTCTATACCATTGTGGGCCTGGGTGGGCCTGGCCTAAATAGAATGCAGTACGCATTCCTCGGTGTATTTATAATATGCTACCTTTCTAATCCAACAC

Full Affymetrix probeset data:

Annotations for 1635502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720