FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635503_at:

>probe:Drosophila_2:1635503_at:468:319; Interrogation_Position=110; Antisense; GCCGCCGATAAGGAGGATAAGATGC
>probe:Drosophila_2:1635503_at:214:79; Interrogation_Position=123; Antisense; AGGATAAGATGCTCGGCTCCTCGTA
>probe:Drosophila_2:1635503_at:170:45; Interrogation_Position=13; Antisense; ATCGCAGTCTGCTACCAACAGTCTA
>probe:Drosophila_2:1635503_at:625:635; Interrogation_Position=135; Antisense; TCGGCTCCTCGTACGGTGGTGGCTA
>probe:Drosophila_2:1635503_at:629:499; Interrogation_Position=19; Antisense; GTCTGCTACCAACAGTCTAAGAAAT
>probe:Drosophila_2:1635503_at:182:659; Interrogation_Position=36; Antisense; TAAGAAATCATCAACCAATCAACAT
>probe:Drosophila_2:1635503_at:245:261; Interrogation_Position=401; Antisense; CAGCCCATCCAGTGGTAGGATGATC
>probe:Drosophila_2:1635503_at:556:485; Interrogation_Position=415; Antisense; GTAGGATGATCCACAGACTTCACTA
>probe:Drosophila_2:1635503_at:448:547; Interrogation_Position=418; Antisense; GGATGATCCACAGACTTCACTAACC
>probe:Drosophila_2:1635503_at:496:705; Interrogation_Position=433; Antisense; TTCACTAACCCCTGATCAACGACAA
>probe:Drosophila_2:1635503_at:406:201; Interrogation_Position=439; Antisense; AACCCCTGATCAACGACAAAAGCAA
>probe:Drosophila_2:1635503_at:609:31; Interrogation_Position=53; Antisense; ATCAACATGAAGTGCATCGCCATCG
>probe:Drosophila_2:1635503_at:525:269; Interrogation_Position=58; Antisense; CATGAAGTGCATCGCCATCGTCTCC
>probe:Drosophila_2:1635503_at:308:319; Interrogation_Position=98; Antisense; GCCGCTTTCGTTGCCGCCGATAAGG

Paste this into a BLAST search page for me
GCCGCCGATAAGGAGGATAAGATGCAGGATAAGATGCTCGGCTCCTCGTAATCGCAGTCTGCTACCAACAGTCTATCGGCTCCTCGTACGGTGGTGGCTAGTCTGCTACCAACAGTCTAAGAAATTAAGAAATCATCAACCAATCAACATCAGCCCATCCAGTGGTAGGATGATCGTAGGATGATCCACAGACTTCACTAGGATGATCCACAGACTTCACTAACCTTCACTAACCCCTGATCAACGACAAAACCCCTGATCAACGACAAAAGCAAATCAACATGAAGTGCATCGCCATCGCATGAAGTGCATCGCCATCGTCTCCGCCGCTTTCGTTGCCGCCGATAAGG

Full Affymetrix probeset data:

Annotations for 1635503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720