FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635506_at:

>probe:Drosophila_2:1635506_at:507:417; Interrogation_Position=126; Antisense; GAGCGACTATTACAGCGGCTGCGTC
>probe:Drosophila_2:1635506_at:429:283; Interrogation_Position=144; Antisense; CTGCGTCTTCATCCGAAACATCAAG
>probe:Drosophila_2:1635506_at:183:143; Interrogation_Position=184; Antisense; ACTGGAGATCCTACGAACACCGGAA
>probe:Drosophila_2:1635506_at:622:103; Interrogation_Position=257; Antisense; AGACCATTAAGCACACTGATCGAGG
>probe:Drosophila_2:1635506_at:92:371; Interrogation_Position=281; Antisense; GAATGGTTTCCATGGCCAACAACGG
>probe:Drosophila_2:1635506_at:281:127; Interrogation_Position=322; Antisense; AGCCAGTTCTTCATTACCTATGCCG
>probe:Drosophila_2:1635506_at:205:403; Interrogation_Position=361; Antisense; GACTTGAAGTACACGCTCTTTGGCC
>probe:Drosophila_2:1635506_at:398:281; Interrogation_Position=376; Antisense; CTCTTTGGCCGTGTGATCGATGGAT
>probe:Drosophila_2:1635506_at:226:107; Interrogation_Position=422; Antisense; AGAAACTGCCCGTCAATCCCAAGAA
>probe:Drosophila_2:1635506_at:597:211; Interrogation_Position=442; Antisense; AAGAACTATCGTCCCCATGTGGACA
>probe:Drosophila_2:1635506_at:101:429; Interrogation_Position=479; Antisense; GAGTAACTATACATGCCAATCCTTT
>probe:Drosophila_2:1635506_at:37:251; Interrogation_Position=495; Antisense; CAATCCTTTGGCGACGTGATAGAGA
>probe:Drosophila_2:1635506_at:674:421; Interrogation_Position=522; Antisense; GAGACAAAGGCCAATCGTACGCTTA
>probe:Drosophila_2:1635506_at:4:79; Interrogation_Position=572; Antisense; AGGTTACGCGATTTCTTCGATTACA

Paste this into a BLAST search page for me
GAGCGACTATTACAGCGGCTGCGTCCTGCGTCTTCATCCGAAACATCAAGACTGGAGATCCTACGAACACCGGAAAGACCATTAAGCACACTGATCGAGGGAATGGTTTCCATGGCCAACAACGGAGCCAGTTCTTCATTACCTATGCCGGACTTGAAGTACACGCTCTTTGGCCCTCTTTGGCCGTGTGATCGATGGATAGAAACTGCCCGTCAATCCCAAGAAAAGAACTATCGTCCCCATGTGGACAGAGTAACTATACATGCCAATCCTTTCAATCCTTTGGCGACGTGATAGAGAGAGACAAAGGCCAATCGTACGCTTAAGGTTACGCGATTTCTTCGATTACA

Full Affymetrix probeset data:

Annotations for 1635506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720