Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635507_at:

>probe:Drosophila_2:1635507_at:366:3; Interrogation_Position=123; Antisense; ATTGGTGGTGACACTACTCGTACTC
>probe:Drosophila_2:1635507_at:406:143; Interrogation_Position=138; Antisense; ACTCGTACTCAGTTCGGATGTCGAA
>probe:Drosophila_2:1635507_at:191:371; Interrogation_Position=16; Antisense; GAAGGAAATATCACCTCGTCCGGGT
>probe:Drosophila_2:1635507_at:395:439; Interrogation_Position=193; Antisense; GAGGCGAACGTGGATCCCAGCGAAT
>probe:Drosophila_2:1635507_at:577:293; Interrogation_Position=213; Antisense; CGAATACCACGGCAATCTGTCGGTG
>probe:Drosophila_2:1635507_at:631:303; Interrogation_Position=29; Antisense; CCTCGTCCGGGTACTTAGCGAATAG
>probe:Drosophila_2:1635507_at:661:503; Interrogation_Position=300; Antisense; GTGCGCCAAGGTGACCAAGTCGGAA
>probe:Drosophila_2:1635507_at:362:219; Interrogation_Position=316; Antisense; AAGTCGGAATTCGTCTATCCCATGT
>probe:Drosophila_2:1635507_at:192:685; Interrogation_Position=331; Antisense; TATCCCATGTGCTGCGGCAACGAAG
>probe:Drosophila_2:1635507_at:459:269; Interrogation_Position=360; Antisense; CATCAAGGACTGGTGCCGGGAGTAT
>probe:Drosophila_2:1635507_at:465:429; Interrogation_Position=379; Antisense; GAGTATGTGTACTTCGGCAACGAGT
>probe:Drosophila_2:1635507_at:106:601; Interrogation_Position=440; Antisense; TGTAAATTGGTTCGCGCTCCTGCAT
>probe:Drosophila_2:1635507_at:104:283; Interrogation_Position=456; Antisense; CTCCTGCATGGATTGGCTGTGATAA
>probe:Drosophila_2:1635507_at:449:573; Interrogation_Position=470; Antisense; GGCTGTGATAAACCCACTGTATTTA

Paste this into a BLAST search page for me
ATTGGTGGTGACACTACTCGTACTCACTCGTACTCAGTTCGGATGTCGAAGAAGGAAATATCACCTCGTCCGGGTGAGGCGAACGTGGATCCCAGCGAATCGAATACCACGGCAATCTGTCGGTGCCTCGTCCGGGTACTTAGCGAATAGGTGCGCCAAGGTGACCAAGTCGGAAAAGTCGGAATTCGTCTATCCCATGTTATCCCATGTGCTGCGGCAACGAAGCATCAAGGACTGGTGCCGGGAGTATGAGTATGTGTACTTCGGCAACGAGTTGTAAATTGGTTCGCGCTCCTGCATCTCCTGCATGGATTGGCTGTGATAAGGCTGTGATAAACCCACTGTATTTA

Full Affymetrix probeset data:

Annotations for 1635507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime