FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635508_at:

>probe:Drosophila_2:1635508_at:575:351; Interrogation_Position=118; Antisense; GCAGAATCCGTAACATCGGCCACGG
>probe:Drosophila_2:1635508_at:388:105; Interrogation_Position=162; Antisense; AGACTCGCCACTAATGCAGTCCGAA
>probe:Drosophila_2:1635508_at:400:87; Interrogation_Position=179; Antisense; AGTCCGAACTGCATTCCGACGAGGA
>probe:Drosophila_2:1635508_at:549:53; Interrogation_Position=310; Antisense; ATGCACATCTTGAAAACGGCTGGCT
>probe:Drosophila_2:1635508_at:5:179; Interrogation_Position=323; Antisense; AAACGGCTGGCTTCTGCACAGTGGA
>probe:Drosophila_2:1635508_at:338:83; Interrogation_Position=342; Antisense; AGTGGACCCCAAGATAGTGCGCCTC
>probe:Drosophila_2:1635508_at:152:639; Interrogation_Position=370; Antisense; TCGGTGTCCGCGCAGAAGTTCATCT
>probe:Drosophila_2:1635508_at:200:215; Interrogation_Position=385; Antisense; AAGTTCATCTCGGATATTGCCAACG
>probe:Drosophila_2:1635508_at:600:541; Interrogation_Position=396; Antisense; GGATATTGCCAACGACGCACTGCAG
>probe:Drosophila_2:1635508_at:211:117; Interrogation_Position=449; Antisense; AGCATTCCAGCGGACACAGTTCCAG
>probe:Drosophila_2:1635508_at:720:373; Interrogation_Position=501; Antisense; GAAGTACACGCTGGCCATGGAGGAC
>probe:Drosophila_2:1635508_at:12:325; Interrogation_Position=561; Antisense; GCGCAAGCCGCAGTATTTCGTTTAG
>probe:Drosophila_2:1635508_at:635:181; Interrogation_Position=76; Antisense; AAAACAATGGCTTCCGATGGCGAGG
>probe:Drosophila_2:1635508_at:93:437; Interrogation_Position=97; Antisense; GAGGACATCAGTGTTACACCCGCAG

Paste this into a BLAST search page for me
GCAGAATCCGTAACATCGGCCACGGAGACTCGCCACTAATGCAGTCCGAAAGTCCGAACTGCATTCCGACGAGGAATGCACATCTTGAAAACGGCTGGCTAAACGGCTGGCTTCTGCACAGTGGAAGTGGACCCCAAGATAGTGCGCCTCTCGGTGTCCGCGCAGAAGTTCATCTAAGTTCATCTCGGATATTGCCAACGGGATATTGCCAACGACGCACTGCAGAGCATTCCAGCGGACACAGTTCCAGGAAGTACACGCTGGCCATGGAGGACGCGCAAGCCGCAGTATTTCGTTTAGAAAACAATGGCTTCCGATGGCGAGGGAGGACATCAGTGTTACACCCGCAG

Full Affymetrix probeset data:

Annotations for 1635508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720