FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635510_at:

>probe:Drosophila_2:1635510_at:401:681; Interrogation_Position=131; Antisense; TATGTTTCGATTTTCGTCTTGCTCT
>probe:Drosophila_2:1635510_at:724:497; Interrogation_Position=146; Antisense; GTCTTGCTCTCGTGACTATTTGAGT
>probe:Drosophila_2:1635510_at:635:433; Interrogation_Position=167; Antisense; GAGTGTAAACGTCCCATCTTGTATT
>probe:Drosophila_2:1635510_at:466:271; Interrogation_Position=181; Antisense; CATCTTGTATTTGTTACCTTGCGGA
>probe:Drosophila_2:1635510_at:723:115; Interrogation_Position=235; Antisense; AGCTTCGACTTTCCGGATTTGCCAA
>probe:Drosophila_2:1635510_at:430:457; Interrogation_Position=250; Antisense; GATTTGCCAAGTGTTCGGATTGTGT
>probe:Drosophila_2:1635510_at:342:725; Interrogation_Position=285; Antisense; TTGAAATGCTTTCCCAAGCTGGAGG
>probe:Drosophila_2:1635510_at:104:549; Interrogation_Position=29; Antisense; GGAGGATCTAGGCAACTTTGTCAAA
>probe:Drosophila_2:1635510_at:505:201; Interrogation_Position=326; Antisense; AACCTGCCTCAAACTTCGATCTGAT
>probe:Drosophila_2:1635510_at:77:451; Interrogation_Position=343; Antisense; GATCTGATTATGAGCTGATATCGCA
>probe:Drosophila_2:1635510_at:186:119; Interrogation_Position=386; Antisense; ACTGTCGATAAATGTTGGTGGTTCT
>probe:Drosophila_2:1635510_at:28:517; Interrogation_Position=403; Antisense; GTGGTTCTAATTGTCTAGGGCCTTT
>probe:Drosophila_2:1635510_at:212:203; Interrogation_Position=52; Antisense; AAGACTTCCGAATTCTAACACAAGG
>probe:Drosophila_2:1635510_at:449:433; Interrogation_Position=95; Antisense; GAGGTATTGCCTTGGAGAAATGTCC

Paste this into a BLAST search page for me
TATGTTTCGATTTTCGTCTTGCTCTGTCTTGCTCTCGTGACTATTTGAGTGAGTGTAAACGTCCCATCTTGTATTCATCTTGTATTTGTTACCTTGCGGAAGCTTCGACTTTCCGGATTTGCCAAGATTTGCCAAGTGTTCGGATTGTGTTTGAAATGCTTTCCCAAGCTGGAGGGGAGGATCTAGGCAACTTTGTCAAAAACCTGCCTCAAACTTCGATCTGATGATCTGATTATGAGCTGATATCGCAACTGTCGATAAATGTTGGTGGTTCTGTGGTTCTAATTGTCTAGGGCCTTTAAGACTTCCGAATTCTAACACAAGGGAGGTATTGCCTTGGAGAAATGTCC

Full Affymetrix probeset data:

Annotations for 1635510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720