Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635513_at:

>probe:Drosophila_2:1635513_at:691:491; Interrogation_Position=1013; Antisense; GTAAACCGCAAGATCCAGTGCTCTA
>probe:Drosophila_2:1635513_at:490:507; Interrogation_Position=1030; Antisense; GTGCTCTATATGCTGGGACGACTTC
>probe:Drosophila_2:1635513_at:312:723; Interrogation_Position=1059; Antisense; TTGACGAGACGGTACGCAAGCTGCC
>probe:Drosophila_2:1635513_at:235:107; Interrogation_Position=1104; Antisense; AGAACTGCATCGTGCCTTGGCTAAA
>probe:Drosophila_2:1635513_at:160:25; Interrogation_Position=1148; Antisense; ATATGCCGCAAGTCACTGGCAGACG
>probe:Drosophila_2:1635513_at:475:363; Interrogation_Position=1193; Antisense; GAATTTGTCATGCTCGATGCCTTCG
>probe:Drosophila_2:1635513_at:527:439; Interrogation_Position=1225; Antisense; GATGGCGGCCGATGGCAGTAATTCC
>probe:Drosophila_2:1635513_at:626:655; Interrogation_Position=1300; Antisense; TAATAATCCCAGTCAGGCAGCGGCG
>probe:Drosophila_2:1635513_at:51:577; Interrogation_Position=1331; Antisense; GGCCGAACACGTCCGGATGCTAATC
>probe:Drosophila_2:1635513_at:109:73; Interrogation_Position=1362; Antisense; AGGCAGCACGCAACAACATCTTTAC
>probe:Drosophila_2:1635513_at:200:189; Interrogation_Position=1376; Antisense; AACATCTTTACCTTTGACGACGACA
>probe:Drosophila_2:1635513_at:233:255; Interrogation_Position=1399; Antisense; CAACATGTTTCTGGACTAGCTGGTA
>probe:Drosophila_2:1635513_at:388:31; Interrogation_Position=1501; Antisense; ATAATAGTTTCTCCTCACGCTTAAT
>probe:Drosophila_2:1635513_at:260:29; Interrogation_Position=1571; Antisense; ATACGATTCCGTTGGCTCTGCAAAA

Paste this into a BLAST search page for me
GTAAACCGCAAGATCCAGTGCTCTAGTGCTCTATATGCTGGGACGACTTCTTGACGAGACGGTACGCAAGCTGCCAGAACTGCATCGTGCCTTGGCTAAAATATGCCGCAAGTCACTGGCAGACGGAATTTGTCATGCTCGATGCCTTCGGATGGCGGCCGATGGCAGTAATTCCTAATAATCCCAGTCAGGCAGCGGCGGGCCGAACACGTCCGGATGCTAATCAGGCAGCACGCAACAACATCTTTACAACATCTTTACCTTTGACGACGACACAACATGTTTCTGGACTAGCTGGTAATAATAGTTTCTCCTCACGCTTAATATACGATTCCGTTGGCTCTGCAAAA

Full Affymetrix probeset data:

Annotations for 1635513_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime