FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635514_at:

>probe:Drosophila_2:1635514_at:358:283; Interrogation_Position=3674; Antisense; CTGCCCCTTTGCCTGGAAAGATTAG
>probe:Drosophila_2:1635514_at:61:103; Interrogation_Position=3710; Antisense; AGAGCAACCTCAACCAGAGCCGGAG
>probe:Drosophila_2:1635514_at:434:551; Interrogation_Position=3731; Antisense; GGAGATTCGGACAACCACCTGCAGA
>probe:Drosophila_2:1635514_at:551:329; Interrogation_Position=3770; Antisense; GCGGCATCCAGGTGACGGTTAAGAA
>probe:Drosophila_2:1635514_at:17:111; Interrogation_Position=3791; Antisense; AGAAGTGATCACAGAGCCGGCCTCA
>probe:Drosophila_2:1635514_at:35:417; Interrogation_Position=3804; Antisense; GAGCCGGCCTCACCATGAGATTATA
>probe:Drosophila_2:1635514_at:100:77; Interrogation_Position=3828; Antisense; AGGAGAATCGAGTTCTACCACAGAA
>probe:Drosophila_2:1635514_at:647:547; Interrogation_Position=3858; Antisense; GGATGTAGCTTAAACCACTCTATAT
>probe:Drosophila_2:1635514_at:315:191; Interrogation_Position=3905; Antisense; AACTTTAGTTAGGTCGATCGTGCAT
>probe:Drosophila_2:1635514_at:433:397; Interrogation_Position=3982; Antisense; GACACTTTTGGTTATATTGGCGGAA
>probe:Drosophila_2:1635514_at:336:3; Interrogation_Position=3997; Antisense; ATTGGCGGAATCTGCGACTGCCAGT
>probe:Drosophila_2:1635514_at:451:405; Interrogation_Position=4012; Antisense; GACTGCCAGTCCTCAGTATTTAAGA
>probe:Drosophila_2:1635514_at:530:365; Interrogation_Position=4070; Antisense; GAATCTCTAGTATACGACTTCGAAA
>probe:Drosophila_2:1635514_at:412:493; Interrogation_Position=4149; Antisense; GTAATGTAATGACTAAGCCCGATCT

Paste this into a BLAST search page for me
CTGCCCCTTTGCCTGGAAAGATTAGAGAGCAACCTCAACCAGAGCCGGAGGGAGATTCGGACAACCACCTGCAGAGCGGCATCCAGGTGACGGTTAAGAAAGAAGTGATCACAGAGCCGGCCTCAGAGCCGGCCTCACCATGAGATTATAAGGAGAATCGAGTTCTACCACAGAAGGATGTAGCTTAAACCACTCTATATAACTTTAGTTAGGTCGATCGTGCATGACACTTTTGGTTATATTGGCGGAAATTGGCGGAATCTGCGACTGCCAGTGACTGCCAGTCCTCAGTATTTAAGAGAATCTCTAGTATACGACTTCGAAAGTAATGTAATGACTAAGCCCGATCT

Full Affymetrix probeset data:

Annotations for 1635514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720