FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635515_at:

>probe:Drosophila_2:1635515_at:186:723; Interrogation_Position=143; Antisense; TTGCTGATGCACTTAACTCGCACTT
>probe:Drosophila_2:1635515_at:262:277; Interrogation_Position=179; Antisense; CTTATAAGGATTCCCACTCGTGCTG
>probe:Drosophila_2:1635515_at:566:285; Interrogation_Position=205; Antisense; CTGTTCTATCCTGGTGTTGCTATAA
>probe:Drosophila_2:1635515_at:87:367; Interrogation_Position=21; Antisense; GAACGGGAACGACCAGGACAACTGT
>probe:Drosophila_2:1635515_at:144:41; Interrogation_Position=260; Antisense; ATCTGTTCTACGTGAAGCAGCCAGC
>probe:Drosophila_2:1635515_at:568:113; Interrogation_Position=275; Antisense; AGCAGCCAGCGGAGTTATTTCAGCA
>probe:Drosophila_2:1635515_at:1:275; Interrogation_Position=307; Antisense; CTTCCGCAGGCGACCATTAAAGCAA
>probe:Drosophila_2:1635515_at:642:13; Interrogation_Position=322; Antisense; ATTAAAGCAATTAGTCCGCCCGTGA
>probe:Drosophila_2:1635515_at:488:397; Interrogation_Position=37; Antisense; GACAACTGTGCCCATGATGACGATG
>probe:Drosophila_2:1635515_at:423:139; Interrogation_Position=382; Antisense; ACGTTTACGCCGCTGTCGACGACAG
>probe:Drosophila_2:1635515_at:260:211; Interrogation_Position=427; Antisense; AAGAAGCTCGTTGACTTCTGGTCCT
>probe:Drosophila_2:1635515_at:302:573; Interrogation_Position=471; Antisense; GGCTGCCATCCATTACAAAGATTTG
>probe:Drosophila_2:1635515_at:666:165; Interrogation_Position=501; Antisense; AAATCGCTTTAAGTGGCATTGCCCG
>probe:Drosophila_2:1635515_at:696:245; Interrogation_Position=552; Antisense; AATTCCAACGACCATCATTTGGTGA

Paste this into a BLAST search page for me
TTGCTGATGCACTTAACTCGCACTTCTTATAAGGATTCCCACTCGTGCTGCTGTTCTATCCTGGTGTTGCTATAAGAACGGGAACGACCAGGACAACTGTATCTGTTCTACGTGAAGCAGCCAGCAGCAGCCAGCGGAGTTATTTCAGCACTTCCGCAGGCGACCATTAAAGCAAATTAAAGCAATTAGTCCGCCCGTGAGACAACTGTGCCCATGATGACGATGACGTTTACGCCGCTGTCGACGACAGAAGAAGCTCGTTGACTTCTGGTCCTGGCTGCCATCCATTACAAAGATTTGAAATCGCTTTAAGTGGCATTGCCCGAATTCCAACGACCATCATTTGGTGA

Full Affymetrix probeset data:

Annotations for 1635515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720