FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635516_at:

>probe:Drosophila_2:1635516_at:578:613; Interrogation_Position=1101; Antisense; TGAAGCCTGGGAGCTACGCATCCTC
>probe:Drosophila_2:1635516_at:497:451; Interrogation_Position=1158; Antisense; GATCTACGAGGAGCGGATGACCTAT
>probe:Drosophila_2:1635516_at:111:681; Interrogation_Position=1180; Antisense; TATGTGCAGGAATACCGCGCCCAAA
>probe:Drosophila_2:1635516_at:177:49; Interrogation_Position=1246; Antisense; ATCCAGTGCGCCGTCAGATTGCAGG
>probe:Drosophila_2:1635516_at:497:411; Interrogation_Position=1295; Antisense; GACGCGGTCTGGGACCATTCAAGAA
>probe:Drosophila_2:1635516_at:342:587; Interrogation_Position=797; Antisense; TGGAGGAACGCATTGCCGACACCAA
>probe:Drosophila_2:1635516_at:692:251; Interrogation_Position=819; Antisense; CAAGTACAAGTTGCGCTGTGTCTCC
>probe:Drosophila_2:1635516_at:533:599; Interrogation_Position=837; Antisense; TGTCTCCCGTGTCAATGACCTCGAG
>probe:Drosophila_2:1635516_at:213:413; Interrogation_Position=853; Antisense; GACCTCGAGTACAGCTTGGTGCAGC
>probe:Drosophila_2:1635516_at:195:535; Interrogation_Position=889; Antisense; GGTCGTCTGGCCCAAGGAACCATTT
>probe:Drosophila_2:1635516_at:104:607; Interrogation_Position=918; Antisense; TGAGAATGCTGAGCGTGCCTACCTA
>probe:Drosophila_2:1635516_at:536:277; Interrogation_Position=936; Antisense; CTACCTACGCGACATTTTGGACATC
>probe:Drosophila_2:1635516_at:597:401; Interrogation_Position=955; Antisense; GACATCAAGCAGAAGCTGGCACGTG
>probe:Drosophila_2:1635516_at:365:123; Interrogation_Position=983; Antisense; AGCGCGTAAGCGCTGAGCTTCGCTC

Paste this into a BLAST search page for me
TGAAGCCTGGGAGCTACGCATCCTCGATCTACGAGGAGCGGATGACCTATTATGTGCAGGAATACCGCGCCCAAAATCCAGTGCGCCGTCAGATTGCAGGGACGCGGTCTGGGACCATTCAAGAATGGAGGAACGCATTGCCGACACCAACAAGTACAAGTTGCGCTGTGTCTCCTGTCTCCCGTGTCAATGACCTCGAGGACCTCGAGTACAGCTTGGTGCAGCGGTCGTCTGGCCCAAGGAACCATTTTGAGAATGCTGAGCGTGCCTACCTACTACCTACGCGACATTTTGGACATCGACATCAAGCAGAAGCTGGCACGTGAGCGCGTAAGCGCTGAGCTTCGCTC

Full Affymetrix probeset data:

Annotations for 1635516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720