FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635517_at:

>probe:Drosophila_2:1635517_at:301:663; Interrogation_Position=1174; Antisense; TAAAGCCCTAACCATTTTATCGCGA
>probe:Drosophila_2:1635517_at:568:699; Interrogation_Position=1189; Antisense; TTTATCGCGAAACACATCGCCAGTT
>probe:Drosophila_2:1635517_at:307:93; Interrogation_Position=1210; Antisense; AGTTAGCCACACAAACACCAGTTGT
>probe:Drosophila_2:1635517_at:388:155; Interrogation_Position=1224; Antisense; ACACCAGTTGTTTCAGTTGTCCCTT
>probe:Drosophila_2:1635517_at:656:597; Interrogation_Position=1241; Antisense; TGTCCCTTGGGCATATTAATATCTC
>probe:Drosophila_2:1635517_at:691:655; Interrogation_Position=1291; Antisense; TAATGCGCTCTTTGTTTTACTTAAA
>probe:Drosophila_2:1635517_at:327:59; Interrogation_Position=787; Antisense; ATGATATCCTTCTTCGATGCGACGT
>probe:Drosophila_2:1635517_at:331:715; Interrogation_Position=799; Antisense; TTCGATGCGACGTACTCTAACTTGT
>probe:Drosophila_2:1635517_at:606:661; Interrogation_Position=816; Antisense; TAACTTGTCGGGTACCTGGCAGATG
>probe:Drosophila_2:1635517_at:725:383; Interrogation_Position=889; Antisense; GAACTTATTACTACTTGGCCGGAGA
>probe:Drosophila_2:1635517_at:66:579; Interrogation_Position=905; Antisense; GGCCGGAGACTCGAGACCTTGTAGA
>probe:Drosophila_2:1635517_at:155:295; Interrogation_Position=916; Antisense; CGAGACCTTGTAGAGCTCATCATCT
>probe:Drosophila_2:1635517_at:480:117; Interrogation_Position=929; Antisense; AGCTCATCATCTATAACTCCCATGA
>probe:Drosophila_2:1635517_at:385:59; Interrogation_Position=974; Antisense; ATGTTGGCGAATTGCTTGTAGCTCA

Paste this into a BLAST search page for me
TAAAGCCCTAACCATTTTATCGCGATTTATCGCGAAACACATCGCCAGTTAGTTAGCCACACAAACACCAGTTGTACACCAGTTGTTTCAGTTGTCCCTTTGTCCCTTGGGCATATTAATATCTCTAATGCGCTCTTTGTTTTACTTAAAATGATATCCTTCTTCGATGCGACGTTTCGATGCGACGTACTCTAACTTGTTAACTTGTCGGGTACCTGGCAGATGGAACTTATTACTACTTGGCCGGAGAGGCCGGAGACTCGAGACCTTGTAGACGAGACCTTGTAGAGCTCATCATCTAGCTCATCATCTATAACTCCCATGAATGTTGGCGAATTGCTTGTAGCTCA

Full Affymetrix probeset data:

Annotations for 1635517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720