Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635518_at:

>probe:Drosophila_2:1635518_at:669:195; Interrogation_Position=3216; Antisense; AACGGAATTGCATATCTTATCTAAT
>probe:Drosophila_2:1635518_at:402:561; Interrogation_Position=3286; Antisense; GGAAAATCATTCAAACGCTAGTGTA
>probe:Drosophila_2:1635518_at:141:693; Interrogation_Position=3312; Antisense; TTTGGATATACATTTCTCACCGATT
>probe:Drosophila_2:1635518_at:123:151; Interrogation_Position=3321; Antisense; ACATTTCTCACCGATTTTGGATATT
>probe:Drosophila_2:1635518_at:601:543; Interrogation_Position=3339; Antisense; GGATATTATCTCAAGTACAACATTA
>probe:Drosophila_2:1635518_at:616:423; Interrogation_Position=3369; Antisense; GATAGATTTTGATAGTTTTACGCCG
>probe:Drosophila_2:1635518_at:120:477; Interrogation_Position=3383; Antisense; GTTTTACGCCGTTTTCTTGCAATGA
>probe:Drosophila_2:1635518_at:285:231; Interrogation_Position=3403; Antisense; AATGAAACCGACAATCTCAGACTTT
>probe:Drosophila_2:1635518_at:335:397; Interrogation_Position=3412; Antisense; GACAATCTCAGACTTTGACCAAAAT
>probe:Drosophila_2:1635518_at:576:27; Interrogation_Position=3461; Antisense; ATACCCGTATACCTTTCATGTTGCA
>probe:Drosophila_2:1635518_at:203:29; Interrogation_Position=3491; Antisense; ATACATTGGCATACCTACAAAGCAA
>probe:Drosophila_2:1635518_at:399:17; Interrogation_Position=3652; Antisense; ATTTACATTTTGATCAGTTCTGGGT
>probe:Drosophila_2:1635518_at:48:35; Interrogation_Position=3664; Antisense; ATCAGTTCTGGGTGTTGGCACCGAA
>probe:Drosophila_2:1635518_at:646:139; Interrogation_Position=3773; Antisense; ACGGAAATTGACTTCCAAATGCGAA

Paste this into a BLAST search page for me
AACGGAATTGCATATCTTATCTAATGGAAAATCATTCAAACGCTAGTGTATTTGGATATACATTTCTCACCGATTACATTTCTCACCGATTTTGGATATTGGATATTATCTCAAGTACAACATTAGATAGATTTTGATAGTTTTACGCCGGTTTTACGCCGTTTTCTTGCAATGAAATGAAACCGACAATCTCAGACTTTGACAATCTCAGACTTTGACCAAAATATACCCGTATACCTTTCATGTTGCAATACATTGGCATACCTACAAAGCAAATTTACATTTTGATCAGTTCTGGGTATCAGTTCTGGGTGTTGGCACCGAAACGGAAATTGACTTCCAAATGCGAA

Full Affymetrix probeset data:

Annotations for 1635518_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime