FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635519_at:

>probe:Drosophila_2:1635519_at:397:469; Interrogation_Position=381; Antisense; GTTCCCCAAGCAAATCAACTACGTG
>probe:Drosophila_2:1635519_at:226:401; Interrogation_Position=418; Antisense; GACTTCGAGAAGATCACCCAGTTCC
>probe:Drosophila_2:1635519_at:43:109; Interrogation_Position=475; Antisense; AGAACGCTCATGTGTCCGGACAAGG
>probe:Drosophila_2:1635519_at:724:119; Interrogation_Position=511; Antisense; AGCGACGTGCCCAGGCGGTATGAAA
>probe:Drosophila_2:1635519_at:109:593; Interrogation_Position=545; Antisense; TGGTGGCCATGGAGTGCATCGCCAA
>probe:Drosophila_2:1635519_at:691:469; Interrogation_Position=636; Antisense; GTTCCACGTGAACTTCGATCGGACA
>probe:Drosophila_2:1635519_at:23:353; Interrogation_Position=671; Antisense; GCAGCTACCAGCGTGAAGACAACAG
>probe:Drosophila_2:1635519_at:568:395; Interrogation_Position=688; Antisense; GACAACAGTTTTGCCTTGAGCGACG
>probe:Drosophila_2:1635519_at:449:417; Interrogation_Position=715; Antisense; GAGACCGAGGGCGAATTCCCATTTG
>probe:Drosophila_2:1635519_at:186:19; Interrogation_Position=735; Antisense; ATTTGTGCGCGGAAAGCTCTTCAAG
>probe:Drosophila_2:1635519_at:620:645; Interrogation_Position=752; Antisense; TCTTCAAGATCGCTTTTGGGCTCGG
>probe:Drosophila_2:1635519_at:583:649; Interrogation_Position=800; Antisense; TCAACGGGCAGTACTTCACCTACTA
>probe:Drosophila_2:1635519_at:700:683; Interrogation_Position=851; Antisense; TATCCACTCTGAAGTGCTTCACCAA
>probe:Drosophila_2:1635519_at:20:583; Interrogation_Position=932; Antisense; TGGCCCGCGTGGAGAAGTTGTCCAT

Paste this into a BLAST search page for me
GTTCCCCAAGCAAATCAACTACGTGGACTTCGAGAAGATCACCCAGTTCCAGAACGCTCATGTGTCCGGACAAGGAGCGACGTGCCCAGGCGGTATGAAATGGTGGCCATGGAGTGCATCGCCAAGTTCCACGTGAACTTCGATCGGACAGCAGCTACCAGCGTGAAGACAACAGGACAACAGTTTTGCCTTGAGCGACGGAGACCGAGGGCGAATTCCCATTTGATTTGTGCGCGGAAAGCTCTTCAAGTCTTCAAGATCGCTTTTGGGCTCGGTCAACGGGCAGTACTTCACCTACTATATCCACTCTGAAGTGCTTCACCAATGGCCCGCGTGGAGAAGTTGTCCAT

Full Affymetrix probeset data:

Annotations for 1635519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720