FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635521_at:

>probe:Drosophila_2:1635521_at:705:365; Interrogation_Position=243; Antisense; GAATGCCGCCGCTGGGAACAACGAT
>probe:Drosophila_2:1635521_at:603:351; Interrogation_Position=309; Antisense; GCAGAAATCACGCACATACGCAGCA
>probe:Drosophila_2:1635521_at:627:351; Interrogation_Position=328; Antisense; GCAGCAGCGGGCAAGATTCAGTCCA
>probe:Drosophila_2:1635521_at:690:461; Interrogation_Position=342; Antisense; GATTCAGTCCATTGGCTACCAGAAC
>probe:Drosophila_2:1635521_at:126:13; Interrogation_Position=383; Antisense; ATATCGCCCTAAGCGAAGCCATGGG
>probe:Drosophila_2:1635521_at:271:605; Interrogation_Position=521; Antisense; TGATCAACGACACGCTGGACGACAT
>probe:Drosophila_2:1635521_at:388:153; Interrogation_Position=542; Antisense; ACATGCTGAATGAGTCCGGCGACGA
>probe:Drosophila_2:1635521_at:588:435; Interrogation_Position=568; Antisense; GAGGAGTCCAATGCCGTAGTCAACA
>probe:Drosophila_2:1635521_at:236:569; Interrogation_Position=610; Antisense; GGCATCGAGATCTCCGGCAAGATGT
>probe:Drosophila_2:1635521_at:9:581; Interrogation_Position=645; Antisense; GGCCACGGGATCCTCAGACTTTGAG
>probe:Drosophila_2:1635521_at:280:105; Interrogation_Position=668; Antisense; AGACGAGTGGCAAGCGCACCGAGAA
>probe:Drosophila_2:1635521_at:510:85; Interrogation_Position=731; Antisense; AGTCCTTACCTGTTTTTCATTCTAT
>probe:Drosophila_2:1635521_at:87:601; Interrogation_Position=758; Antisense; TGTAACTACTGTGAACATCGCTGTT
>probe:Drosophila_2:1635521_at:335:635; Interrogation_Position=775; Antisense; TCGCTGTTATCCATAGCCCGTAAGA

Paste this into a BLAST search page for me
GAATGCCGCCGCTGGGAACAACGATGCAGAAATCACGCACATACGCAGCAGCAGCAGCGGGCAAGATTCAGTCCAGATTCAGTCCATTGGCTACCAGAACATATCGCCCTAAGCGAAGCCATGGGTGATCAACGACACGCTGGACGACATACATGCTGAATGAGTCCGGCGACGAGAGGAGTCCAATGCCGTAGTCAACAGGCATCGAGATCTCCGGCAAGATGTGGCCACGGGATCCTCAGACTTTGAGAGACGAGTGGCAAGCGCACCGAGAAAGTCCTTACCTGTTTTTCATTCTATTGTAACTACTGTGAACATCGCTGTTTCGCTGTTATCCATAGCCCGTAAGA

Full Affymetrix probeset data:

Annotations for 1635521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720