FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635524_at:

>probe:Drosophila_2:1635524_at:343:721; Interrogation_Position=1279; Antisense; TTCCTACTCCTGATCTTTGGACAAC
>probe:Drosophila_2:1635524_at:460:137; Interrogation_Position=1302; Antisense; ACGTCGCTTCATGATTCGGGTTCAA
>probe:Drosophila_2:1635524_at:500:373; Interrogation_Position=1348; Antisense; GAAGTTTTGCAGTTCTTTACCACGC
>probe:Drosophila_2:1635524_at:196:699; Interrogation_Position=1363; Antisense; TTTACCACGCGAAGCTGGGACTTTA
>probe:Drosophila_2:1635524_at:203:403; Interrogation_Position=1381; Antisense; GACTTTAAATCCACACACTTCGAGC
>probe:Drosophila_2:1635524_at:493:217; Interrogation_Position=1487; Antisense; AAGTCAGTATTTTGGGTGGCCGTCA
>probe:Drosophila_2:1635524_at:567:189; Interrogation_Position=1533; Antisense; AACTTCGTTGCCGAAATCACGCATA
>probe:Drosophila_2:1635524_at:494:427; Interrogation_Position=1563; Antisense; GAGATTCATGTATGTCCTGGACCGT
>probe:Drosophila_2:1635524_at:443:61; Interrogation_Position=1574; Antisense; ATGTCCTGGACCGTATTTGCAAAAC
>probe:Drosophila_2:1635524_at:100:139; Interrogation_Position=1597; Antisense; ACGATGATAATTTCAGGCCTTCTAT
>probe:Drosophila_2:1635524_at:73:79; Interrogation_Position=1610; Antisense; CAGGCCTTCTATATTGGGTTTCCCA
>probe:Drosophila_2:1635524_at:171:379; Interrogation_Position=1661; Antisense; GAAGCGTATTCCATTCTAGTACATA
>probe:Drosophila_2:1635524_at:61:149; Interrogation_Position=1686; Antisense; ACATTCTTCTTCAGTTGCTTTTTTA
>probe:Drosophila_2:1635524_at:243:487; Interrogation_Position=1718; Antisense; GTACCTTTTATTTCATGTGCCTTTG

Paste this into a BLAST search page for me
TTCCTACTCCTGATCTTTGGACAACACGTCGCTTCATGATTCGGGTTCAAGAAGTTTTGCAGTTCTTTACCACGCTTTACCACGCGAAGCTGGGACTTTAGACTTTAAATCCACACACTTCGAGCAAGTCAGTATTTTGGGTGGCCGTCAAACTTCGTTGCCGAAATCACGCATAGAGATTCATGTATGTCCTGGACCGTATGTCCTGGACCGTATTTGCAAAACACGATGATAATTTCAGGCCTTCTATCAGGCCTTCTATATTGGGTTTCCCAGAAGCGTATTCCATTCTAGTACATAACATTCTTCTTCAGTTGCTTTTTTAGTACCTTTTATTTCATGTGCCTTTG

Full Affymetrix probeset data:

Annotations for 1635524_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720