FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635525_at:

>probe:Drosophila_2:1635525_at:542:407; Interrogation_Position=246; Antisense; GACGGCAAGGATACCCCATGGGCTG
>probe:Drosophila_2:1635525_at:344:471; Interrogation_Position=273; Antisense; GTTCTGTTCGCCGTGACCGTAGGAT
>probe:Drosophila_2:1635525_at:392:449; Interrogation_Position=295; Antisense; GATCGGTGGATCTCTACAATGGCAA
>probe:Drosophila_2:1635525_at:585:435; Interrogation_Position=333; Antisense; GAGGAGATCACCATTAACCCGAACT
>probe:Drosophila_2:1635525_at:548:709; Interrogation_Position=346; Antisense; TTAACCCGAACTACAGCACTCTGAA
>probe:Drosophila_2:1635525_at:683:511; Interrogation_Position=415; Antisense; GTGAGACAGTCAATGCCATTCCACT
>probe:Drosophila_2:1635525_at:9:433; Interrogation_Position=501; Antisense; GAGTCCGAGGTGAACATGCATCGCA
>probe:Drosophila_2:1635525_at:110:53; Interrogation_Position=516; Antisense; ATGCATCGCACCCTGCAAATAGGAG
>probe:Drosophila_2:1635525_at:137:69; Interrogation_Position=628; Antisense; ATGGCCGTCGTCAGGGAATCTGCAG
>probe:Drosophila_2:1635525_at:479:557; Interrogation_Position=656; Antisense; GGACATTGGAGGACCGGCCGTCTAC
>probe:Drosophila_2:1635525_at:96:501; Interrogation_Position=697; Antisense; GTCTGGGTGCACAGATCCTTGGCGA
>probe:Drosophila_2:1635525_at:604:563; Interrogation_Position=729; Antisense; GGAATGCTGCCCGAACGATTCATTA
>probe:Drosophila_2:1635525_at:644:381; Interrogation_Position=741; Antisense; GAACGATTCATTAGCATTGCGGCCA
>probe:Drosophila_2:1635525_at:157:9; Interrogation_Position=756; Antisense; ATTGCGGCCAACTACGATTGGATCC

Paste this into a BLAST search page for me
GACGGCAAGGATACCCCATGGGCTGGTTCTGTTCGCCGTGACCGTAGGATGATCGGTGGATCTCTACAATGGCAAGAGGAGATCACCATTAACCCGAACTTTAACCCGAACTACAGCACTCTGAAGTGAGACAGTCAATGCCATTCCACTGAGTCCGAGGTGAACATGCATCGCAATGCATCGCACCCTGCAAATAGGAGATGGCCGTCGTCAGGGAATCTGCAGGGACATTGGAGGACCGGCCGTCTACGTCTGGGTGCACAGATCCTTGGCGAGGAATGCTGCCCGAACGATTCATTAGAACGATTCATTAGCATTGCGGCCAATTGCGGCCAACTACGATTGGATCC

Full Affymetrix probeset data:

Annotations for 1635525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720