FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635526_at:

>probe:Drosophila_2:1635526_at:664:639; Interrogation_Position=369; Antisense; TCTGGAGGGCCTGTCAATTCGGCGA
>probe:Drosophila_2:1635526_at:328:11; Interrogation_Position=385; Antisense; ATTCGGCGAGAATCTACTGCACCTG
>probe:Drosophila_2:1635526_at:132:93; Interrogation_Position=429; Antisense; AGTTACTGGACGTTAGCGACTCCCA
>probe:Drosophila_2:1635526_at:7:151; Interrogation_Position=468; Antisense; ACATCGGCTTCCTTCAAAGTCGCGT
>probe:Drosophila_2:1635526_at:435:385; Interrogation_Position=526; Antisense; GAACAGTCCGGATTTGATAGCACAA
>probe:Drosophila_2:1635526_at:475:417; Interrogation_Position=614; Antisense; GAGTTGGTTAAATCGGCAGCCCTTA
>probe:Drosophila_2:1635526_at:603:123; Interrogation_Position=631; Antisense; AGCCCTTACCTTGTCATTCGAGGAG
>probe:Drosophila_2:1635526_at:574:9; Interrogation_Position=646; Antisense; ATTCGAGGAGCTGCGTTGTCGCCAC
>probe:Drosophila_2:1635526_at:709:587; Interrogation_Position=682; Antisense; TCGTTTGGGCCTCTTTAAGCCACGA
>probe:Drosophila_2:1635526_at:287:205; Interrogation_Position=714; Antisense; AAGCCGATCCAAATGAGCCGACTAC
>probe:Drosophila_2:1635526_at:119:673; Interrogation_Position=736; Antisense; TACGAACCCCAAACTCTATCAGATT
>probe:Drosophila_2:1635526_at:706:695; Interrogation_Position=781; Antisense; TTTCGCCACAAAGATTTGCCACGTC
>probe:Drosophila_2:1635526_at:134:305; Interrogation_Position=808; Antisense; CCTGCCGGAATACGAAGCCTTCAAG
>probe:Drosophila_2:1635526_at:234:647; Interrogation_Position=828; Antisense; TCAAGGATCTCTACGCCAAGGAACT

Paste this into a BLAST search page for me
TCTGGAGGGCCTGTCAATTCGGCGAATTCGGCGAGAATCTACTGCACCTGAGTTACTGGACGTTAGCGACTCCCAACATCGGCTTCCTTCAAAGTCGCGTGAACAGTCCGGATTTGATAGCACAAGAGTTGGTTAAATCGGCAGCCCTTAAGCCCTTACCTTGTCATTCGAGGAGATTCGAGGAGCTGCGTTGTCGCCACTCGTTTGGGCCTCTTTAAGCCACGAAAGCCGATCCAAATGAGCCGACTACTACGAACCCCAAACTCTATCAGATTTTTCGCCACAAAGATTTGCCACGTCCCTGCCGGAATACGAAGCCTTCAAGTCAAGGATCTCTACGCCAAGGAACT

Full Affymetrix probeset data:

Annotations for 1635526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720