Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635527_at:

>probe:Drosophila_2:1635527_at:379:29; Interrogation_Position=123; Antisense; ATACTGCATCCGGACGACGGTCAAT
>probe:Drosophila_2:1635527_at:57:409; Interrogation_Position=138; Antisense; GACGGTCAATACATATGGCTGCCAA
>probe:Drosophila_2:1635527_at:577:243; Interrogation_Position=161; Antisense; AATTTCCGTGCTCGTTGGCATTTTC
>probe:Drosophila_2:1635527_at:243:61; Interrogation_Position=210; Antisense; ATGTCACGTAGTCGCTGTCGGAATT
>probe:Drosophila_2:1635527_at:686:361; Interrogation_Position=230; Antisense; GAATTCCTGGGATTGCCTAAAGAGC
>probe:Drosophila_2:1635527_at:401:549; Interrogation_Position=293; Antisense; GGAGGATTCCGATGTGCCCATGGAC
>probe:Drosophila_2:1635527_at:635:29; Interrogation_Position=394; Antisense; ATAACGCCTCCAATGCCTAGTGAAT
>probe:Drosophila_2:1635527_at:249:257; Interrogation_Position=436; Antisense; CACTTTATTGTCCACGTTGTCTTCA
>probe:Drosophila_2:1635527_at:574:513; Interrogation_Position=49; Antisense; GTGATTTCTTTGTACATCCCCTGAA
>probe:Drosophila_2:1635527_at:153:175; Interrogation_Position=494; Antisense; AAACTACGTGCCTCTACTACAAGTA
>probe:Drosophila_2:1635527_at:727:655; Interrogation_Position=540; Antisense; TAATGATCCGTACTGGTGGCGCCAA
>probe:Drosophila_2:1635527_at:317:543; Interrogation_Position=565; Antisense; GGATTCGCGTCGTCAGGTCGTAGAA
>probe:Drosophila_2:1635527_at:178:211; Interrogation_Position=594; Antisense; AAGAAGAATGCACCGCCCAGTGTGA
>probe:Drosophila_2:1635527_at:649:665; Interrogation_Position=85; Antisense; TACTTGAGCCTCAGACGACCATTAG

Paste this into a BLAST search page for me
ATACTGCATCCGGACGACGGTCAATGACGGTCAATACATATGGCTGCCAAAATTTCCGTGCTCGTTGGCATTTTCATGTCACGTAGTCGCTGTCGGAATTGAATTCCTGGGATTGCCTAAAGAGCGGAGGATTCCGATGTGCCCATGGACATAACGCCTCCAATGCCTAGTGAATCACTTTATTGTCCACGTTGTCTTCAGTGATTTCTTTGTACATCCCCTGAAAAACTACGTGCCTCTACTACAAGTATAATGATCCGTACTGGTGGCGCCAAGGATTCGCGTCGTCAGGTCGTAGAAAAGAAGAATGCACCGCCCAGTGTGATACTTGAGCCTCAGACGACCATTAG

Full Affymetrix probeset data:

Annotations for 1635527_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime