FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635530_at:

>probe:Drosophila_2:1635530_at:717:419; Interrogation_Position=196; Antisense; GAGGAGTTTAACACCGGCCCGCTGT
>probe:Drosophila_2:1635530_at:144:503; Interrogation_Position=234; Antisense; GTCCGTGAAGAACAACACCCAGGTG
>probe:Drosophila_2:1635530_at:53:81; Interrogation_Position=254; Antisense; AGGTGCTCATCAACTGCCGCAACAA
>probe:Drosophila_2:1635530_at:207:529; Interrogation_Position=296; Antisense; GGGTAAAGGCCTTCGATCGGCACTG
>probe:Drosophila_2:1635530_at:210:641; Interrogation_Position=312; Antisense; TCGGCACTGCAACATGGTACTGGAA
>probe:Drosophila_2:1635530_at:695:373; Interrogation_Position=423; Antisense; GAAGATGTTCCTGCGAGGCGATTCT
>probe:Drosophila_2:1635530_at:66:463; Interrogation_Position=442; Antisense; GATTCTGTCATCCTGGTCCTAAGGA
>probe:Drosophila_2:1635530_at:482:573; Interrogation_Position=480; Antisense; GGCGGCCGGCAAGTAGTCTACCATA
>probe:Drosophila_2:1635530_at:113:123; Interrogation_Position=504; Antisense; AGCGATAGCGTACAGCAACCAATAT
>probe:Drosophila_2:1635530_at:591:359; Interrogation_Position=518; Antisense; GCAACCAATATCCATCAACTTCAGT
>probe:Drosophila_2:1635530_at:645:471; Interrogation_Position=570; Antisense; GTTCTGTGGACCAAAATGTGCCATT
>probe:Drosophila_2:1635530_at:475:1; Interrogation_Position=619; Antisense; ACGACGGAAAATATCCCATCCCAGT
>probe:Drosophila_2:1635530_at:27:291; Interrogation_Position=634; Antisense; CCATCCCAGTAACATATCCCATTAT
>probe:Drosophila_2:1635530_at:342:491; Interrogation_Position=676; Antisense; GTACAATCCGTAATCGCAATTTCTT

Paste this into a BLAST search page for me
GAGGAGTTTAACACCGGCCCGCTGTGTCCGTGAAGAACAACACCCAGGTGAGGTGCTCATCAACTGCCGCAACAAGGGTAAAGGCCTTCGATCGGCACTGTCGGCACTGCAACATGGTACTGGAAGAAGATGTTCCTGCGAGGCGATTCTGATTCTGTCATCCTGGTCCTAAGGAGGCGGCCGGCAAGTAGTCTACCATAAGCGATAGCGTACAGCAACCAATATGCAACCAATATCCATCAACTTCAGTGTTCTGTGGACCAAAATGTGCCATTACGACGGAAAATATCCCATCCCAGTCCATCCCAGTAACATATCCCATTATGTACAATCCGTAATCGCAATTTCTT

Full Affymetrix probeset data:

Annotations for 1635530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720