FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635531_at:

>probe:Drosophila_2:1635531_at:679:333; Interrogation_Position=1003; Antisense; GCTGCTCTTTGGACTCTACAAGTTG
>probe:Drosophila_2:1635531_at:612:273; Interrogation_Position=1047; Antisense; CATTCAGTGTGGTTTGGTCTCCTCA
>probe:Drosophila_2:1635531_at:155:499; Interrogation_Position=1063; Antisense; GTCTCCTCATGCTGTGGGTCTGATA
>probe:Drosophila_2:1635531_at:454:5; Interrogation_Position=1114; Antisense; ATTGAATATCACCTCATGGGCACCC
>probe:Drosophila_2:1635531_at:197:133; Interrogation_Position=1135; Antisense; ACCCGCACGTATACCATGTTCTTAT
>probe:Drosophila_2:1635531_at:605:7; Interrogation_Position=1164; Antisense; ATTGCCAGCATTATGTAACTCCCAT
>probe:Drosophila_2:1635531_at:316:491; Interrogation_Position=1178; Antisense; GTAACTCCCATTAACAAATCCATCC
>probe:Drosophila_2:1635531_at:24:223; Interrogation_Position=1218; Antisense; AAGGGAGTCGCACACTTGCATGCAT
>probe:Drosophila_2:1635531_at:105:323; Interrogation_Position=1377; Antisense; TGTTGAAAATACTCTACCCAAGGGT
>probe:Drosophila_2:1635531_at:711:583; Interrogation_Position=904; Antisense; TGGCAATCACTACGTGTATCCCATT
>probe:Drosophila_2:1635531_at:376:387; Interrogation_Position=937; Antisense; GAACAATCCCAACCGCTGTATGGTG
>probe:Drosophila_2:1635531_at:681:679; Interrogation_Position=955; Antisense; TATGGTGACCTTTGTGGGCATCTTC
>probe:Drosophila_2:1635531_at:359:345; Interrogation_Position=972; Antisense; GCATCTTCCTGCTCATTATGTGCTA
>probe:Drosophila_2:1635531_at:334:15; Interrogation_Position=986; Antisense; ATTATGTGCTACTGGGTGCTGCTCT

Paste this into a BLAST search page for me
GCTGCTCTTTGGACTCTACAAGTTGCATTCAGTGTGGTTTGGTCTCCTCAGTCTCCTCATGCTGTGGGTCTGATAATTGAATATCACCTCATGGGCACCCACCCGCACGTATACCATGTTCTTATATTGCCAGCATTATGTAACTCCCATGTAACTCCCATTAACAAATCCATCCAAGGGAGTCGCACACTTGCATGCATTGTTGAAAATACTCTACCCAAGGGTTGGCAATCACTACGTGTATCCCATTGAACAATCCCAACCGCTGTATGGTGTATGGTGACCTTTGTGGGCATCTTCGCATCTTCCTGCTCATTATGTGCTAATTATGTGCTACTGGGTGCTGCTCT

Full Affymetrix probeset data:

Annotations for 1635531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720