FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635535_at:

>probe:Drosophila_2:1635535_at:392:405; Interrogation_Position=1026; Antisense; GACTGGCCAGCATGTCGTTGTACGG
>probe:Drosophila_2:1635535_at:408:725; Interrogation_Position=1043; Antisense; TTGTACGGCGGACTGATTCTGTTCA
>probe:Drosophila_2:1635535_at:682:601; Interrogation_Position=1056; Antisense; TGATTCTGTTCAGCGGATTTCTTCT
>probe:Drosophila_2:1635535_at:130:543; Interrogation_Position=1070; Antisense; GGATTTCTTCTGTACGATACCCAAA
>probe:Drosophila_2:1635535_at:467:671; Interrogation_Position=1087; Antisense; TACCCAAAGGATCGTTAAGTCGGCG
>probe:Drosophila_2:1635535_at:2:657; Interrogation_Position=1102; Antisense; TAAGTCGGCGGAGTTGTATCCCCAG
>probe:Drosophila_2:1635535_at:111:3; Interrogation_Position=1117; Antisense; GTATCCCCAGTACAGTAAATTCCCT
>probe:Drosophila_2:1635535_at:458:261; Interrogation_Position=1129; Antisense; CAGTAAATTCCCTTACGATCCAATT
>probe:Drosophila_2:1635535_at:173:449; Interrogation_Position=1145; Antisense; GATCCAATTAATCATGCCCTGGCCA
>probe:Drosophila_2:1635535_at:67:315; Interrogation_Position=1166; Antisense; GCCATTTACATGGATGCGCTCAACA
>probe:Drosophila_2:1635535_at:21:653; Interrogation_Position=1185; Antisense; TCAACATCTTTATCCGCATCGCAAT
>probe:Drosophila_2:1635535_at:129:71; Interrogation_Position=855; Antisense; AGGCCCTTTTGTACACCAGCGGAAT
>probe:Drosophila_2:1635535_at:108:129; Interrogation_Position=869; Antisense; ACCAGCGGAATCGTGGGTGCCCTGT
>probe:Drosophila_2:1635535_at:662:215; Interrogation_Position=923; Antisense; AAGTTCCTGCATATGGGCGGACCGC

Paste this into a BLAST search page for me
GACTGGCCAGCATGTCGTTGTACGGTTGTACGGCGGACTGATTCTGTTCATGATTCTGTTCAGCGGATTTCTTCTGGATTTCTTCTGTACGATACCCAAATACCCAAAGGATCGTTAAGTCGGCGTAAGTCGGCGGAGTTGTATCCCCAGGTATCCCCAGTACAGTAAATTCCCTCAGTAAATTCCCTTACGATCCAATTGATCCAATTAATCATGCCCTGGCCAGCCATTTACATGGATGCGCTCAACATCAACATCTTTATCCGCATCGCAATAGGCCCTTTTGTACACCAGCGGAATACCAGCGGAATCGTGGGTGCCCTGTAAGTTCCTGCATATGGGCGGACCGC

Full Affymetrix probeset data:

Annotations for 1635535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720