FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635537_at:

>probe:Drosophila_2:1635537_at:704:587; Interrogation_Position=1027; Antisense; TGGATAACTTAGCACTCCTGGTCCT
>probe:Drosophila_2:1635537_at:207:179; Interrogation_Position=1122; Antisense; AAACATGCATTTTCTTAGCTATATT
>probe:Drosophila_2:1635537_at:430:21; Interrogation_Position=1142; Antisense; ATATTTGACTTTTCTGTGCGCACTT
>probe:Drosophila_2:1635537_at:547:285; Interrogation_Position=1155; Antisense; CTGTGCGCACTTATTTGTGTTTGAA
>probe:Drosophila_2:1635537_at:695:651; Interrogation_Position=1187; Antisense; TAATACGTTCATGGCAAAGTTCAGT
>probe:Drosophila_2:1635537_at:275:473; Interrogation_Position=1205; Antisense; GTTCAGTTGGCCGTGTTCAATAGAA
>probe:Drosophila_2:1635537_at:689:613; Interrogation_Position=1272; Antisense; TGCACTTGTACAGCATTAATGCCTA
>probe:Drosophila_2:1635537_at:84:35; Interrogation_Position=1466; Antisense; ATCAGGACGGCATTTTATTATATTT
>probe:Drosophila_2:1635537_at:700:193; Interrogation_Position=927; Antisense; AACTCCAACTCACTGGCCATGGAAT
>probe:Drosophila_2:1635537_at:242:269; Interrogation_Position=944; Antisense; CATGGAATGTTGAGAGCTGCCGGCA
>probe:Drosophila_2:1635537_at:268:419; Interrogation_Position=957; Antisense; GAGCTGCCGGCAGTCCGAACAATGA
>probe:Drosophila_2:1635537_at:514:387; Interrogation_Position=973; Antisense; GAACAATGACCACACTAACACACTG
>probe:Drosophila_2:1635537_at:375:147; Interrogation_Position=986; Antisense; ACTAACACACTGTCTCTCACTTAAA
>probe:Drosophila_2:1635537_at:448:497; Interrogation_Position=997; Antisense; GTCTCTCACTTAAACCAACATGGGC

Paste this into a BLAST search page for me
TGGATAACTTAGCACTCCTGGTCCTAAACATGCATTTTCTTAGCTATATTATATTTGACTTTTCTGTGCGCACTTCTGTGCGCACTTATTTGTGTTTGAATAATACGTTCATGGCAAAGTTCAGTGTTCAGTTGGCCGTGTTCAATAGAATGCACTTGTACAGCATTAATGCCTAATCAGGACGGCATTTTATTATATTTAACTCCAACTCACTGGCCATGGAATCATGGAATGTTGAGAGCTGCCGGCAGAGCTGCCGGCAGTCCGAACAATGAGAACAATGACCACACTAACACACTGACTAACACACTGTCTCTCACTTAAAGTCTCTCACTTAAACCAACATGGGC

Full Affymetrix probeset data:

Annotations for 1635537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720