FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635538_at:

>probe:Drosophila_2:1635538_at:282:571; Interrogation_Position=1905; Antisense; GGCTATTCTAATCGAGTTTCCTTTC
>probe:Drosophila_2:1635538_at:596:585; Interrogation_Position=1945; Antisense; TGGACAACGCTCGTTTTCACCATAG
>probe:Drosophila_2:1635538_at:317:127; Interrogation_Position=1968; Antisense; AGCCATTGTGTATAGCGTTGCCTGT
>probe:Drosophila_2:1635538_at:318:605; Interrogation_Position=1997; Antisense; TGATTATGCCGTTCGCCATGATCTA
>probe:Drosophila_2:1635538_at:65:317; Interrogation_Position=2065; Antisense; GCCTACGGTCCGTCAAACATGATAT
>probe:Drosophila_2:1635538_at:687:171; Interrogation_Position=2133; Antisense; AAAGTTCTCGGTCGTGATCCTGGTA
>probe:Drosophila_2:1635538_at:473:47; Interrogation_Position=2149; Antisense; ATCCTGGTACTGGTCATGGCCATGA
>probe:Drosophila_2:1635538_at:188:69; Interrogation_Position=2164; Antisense; ATGGCCATGATTTGTTTCTTCCGTG
>probe:Drosophila_2:1635538_at:140:371; Interrogation_Position=2198; Antisense; GAATGGCTCGATTCCTGCTGCTTAT
>probe:Drosophila_2:1635538_at:46:125; Interrogation_Position=2227; Antisense; AGCCTGGCTATCACATTGACTTTGT
>probe:Drosophila_2:1635538_at:489:403; Interrogation_Position=2244; Antisense; GACTTTGTTCACCTTTATGTCACCA
>probe:Drosophila_2:1635538_at:348:323; Interrogation_Position=2289; Antisense; GCGCCGCCCAAGCATTGTGGAAATT
>probe:Drosophila_2:1635538_at:536:37; Interrogation_Position=2329; Antisense; ATCTACGTGCCCGATGTGCTGAAAG
>probe:Drosophila_2:1635538_at:38:517; Interrogation_Position=2422; Antisense; GTGTCCGAGTACGACAGCTCACAAT

Paste this into a BLAST search page for me
GGCTATTCTAATCGAGTTTCCTTTCTGGACAACGCTCGTTTTCACCATAGAGCCATTGTGTATAGCGTTGCCTGTTGATTATGCCGTTCGCCATGATCTAGCCTACGGTCCGTCAAACATGATATAAAGTTCTCGGTCGTGATCCTGGTAATCCTGGTACTGGTCATGGCCATGAATGGCCATGATTTGTTTCTTCCGTGGAATGGCTCGATTCCTGCTGCTTATAGCCTGGCTATCACATTGACTTTGTGACTTTGTTCACCTTTATGTCACCAGCGCCGCCCAAGCATTGTGGAAATTATCTACGTGCCCGATGTGCTGAAAGGTGTCCGAGTACGACAGCTCACAAT

Full Affymetrix probeset data:

Annotations for 1635538_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720