Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635541_s_at:

>probe:Drosophila_2:1635541_s_at:201:569; Interrogation_Position=168; Antisense; GGCAGCTGAGCCTTCGCGTTGGCAA
>probe:Drosophila_2:1635541_s_at:195:317; Interrogation_Position=181; Antisense; TCGCGTTGGCAATCGCCTTCGGGAG
>probe:Drosophila_2:1635541_s_at:42:529; Interrogation_Position=201; Antisense; GGGAGACGGCCATCAATTGCACCAG
>probe:Drosophila_2:1635541_s_at:352:315; Interrogation_Position=209; Antisense; GCCATCAATTGCACCAGCAGCAACT
>probe:Drosophila_2:1635541_s_at:421:655; Interrogation_Position=262; Antisense; TAATAATGCGGATGGTCGCAGCGTC
>probe:Drosophila_2:1635541_s_at:563:635; Interrogation_Position=304; Antisense; TCTGGAGAACGGAAACGGATGTGCC
>probe:Drosophila_2:1635541_s_at:292:493; Interrogation_Position=351; Antisense; GTAATGGCAACCGAGCCTACGTGAC
>probe:Drosophila_2:1635541_s_at:335:415; Interrogation_Position=363; Antisense; GAGCCTACGTGACCACGGACACATC
>probe:Drosophila_2:1635541_s_at:173:395; Interrogation_Position=380; Antisense; GACACATCGGGCACGCTTTACTACG
>probe:Drosophila_2:1635541_s_at:477:341; Interrogation_Position=394; Antisense; GCTTTACTACGGCACCCAGAGCAAC
>probe:Drosophila_2:1635541_s_at:528:121; Interrogation_Position=40; Antisense; AGCGAGTTCGCCCTGTGGAACTAAA
>probe:Drosophila_2:1635541_s_at:197:95; Interrogation_Position=420; Antisense; AGATACGCATCACAGAGAACCCACT
>probe:Drosophila_2:1635541_s_at:244:585; Interrogation_Position=55; Antisense; TGGAACTAAATACCACACCTACTCC
>probe:Drosophila_2:1635541_s_at:439:15; Interrogation_Position=83; Antisense; ATCTTCTTTGCCAACTTCCGGGAGC

Paste this into a BLAST search page for me
GGCAGCTGAGCCTTCGCGTTGGCAATCGCGTTGGCAATCGCCTTCGGGAGGGGAGACGGCCATCAATTGCACCAGGCCATCAATTGCACCAGCAGCAACTTAATAATGCGGATGGTCGCAGCGTCTCTGGAGAACGGAAACGGATGTGCCGTAATGGCAACCGAGCCTACGTGACGAGCCTACGTGACCACGGACACATCGACACATCGGGCACGCTTTACTACGGCTTTACTACGGCACCCAGAGCAACAGCGAGTTCGCCCTGTGGAACTAAAAGATACGCATCACAGAGAACCCACTTGGAACTAAATACCACACCTACTCCATCTTCTTTGCCAACTTCCGGGAGC

Full Affymetrix probeset data:

Annotations for 1635541_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime