FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635542_at:

>probe:Drosophila_2:1635542_at:376:455; Interrogation_Position=1976; Antisense; GATAATGTTGCAACTTCCTCCAAGT
>probe:Drosophila_2:1635542_at:540:579; Interrogation_Position=2011; Antisense; GGCCATGCATCAGGGCAGCGGTCTT
>probe:Drosophila_2:1635542_at:379:251; Interrogation_Position=2074; Antisense; CAAGTGCCCGTTCCTGCAGAAAACG
>probe:Drosophila_2:1635542_at:356:257; Interrogation_Position=2102; Antisense; CAAATGTTCGACTACGCCGACGAGG
>probe:Drosophila_2:1635542_at:51:265; Interrogation_Position=2141; Antisense; CAGCACTCGGTGCTCATTGAGGATG
>probe:Drosophila_2:1635542_at:583:585; Interrogation_Position=2166; Antisense; TGGAAAACCTGTTCTGCGGTCTCTA
>probe:Drosophila_2:1635542_at:680:103; Interrogation_Position=2244; Antisense; AGACGCTGGCGGAGGACCTGATCAA
>probe:Drosophila_2:1635542_at:6:13; Interrogation_Position=2309; Antisense; ATTCACGGCAAAGTGGCGTCGTCTT
>probe:Drosophila_2:1635542_at:185:417; Interrogation_Position=2334; Antisense; GAGCCCGTCATCAATATCATCGTTT
>probe:Drosophila_2:1635542_at:616:281; Interrogation_Position=2406; Antisense; CTCGTTGTTGAACTCCCGTGGAGAA
>probe:Drosophila_2:1635542_at:666:617; Interrogation_Position=2435; Antisense; TGCTTCCCCTGATTTAACATCGGTA
>probe:Drosophila_2:1635542_at:498:691; Interrogation_Position=2458; Antisense; TATTGTATTCAATCCTTCTGCTCTC
>probe:Drosophila_2:1635542_at:401:643; Interrogation_Position=2479; Antisense; TCTCCCCGGCGAATGCATCGTTAAT
>probe:Drosophila_2:1635542_at:554:271; Interrogation_Position=2494; Antisense; CATCGTTAATGGTTGGTTTCCGCGT

Paste this into a BLAST search page for me
GATAATGTTGCAACTTCCTCCAAGTGGCCATGCATCAGGGCAGCGGTCTTCAAGTGCCCGTTCCTGCAGAAAACGCAAATGTTCGACTACGCCGACGAGGCAGCACTCGGTGCTCATTGAGGATGTGGAAAACCTGTTCTGCGGTCTCTAAGACGCTGGCGGAGGACCTGATCAAATTCACGGCAAAGTGGCGTCGTCTTGAGCCCGTCATCAATATCATCGTTTCTCGTTGTTGAACTCCCGTGGAGAATGCTTCCCCTGATTTAACATCGGTATATTGTATTCAATCCTTCTGCTCTCTCTCCCCGGCGAATGCATCGTTAATCATCGTTAATGGTTGGTTTCCGCGT

Full Affymetrix probeset data:

Annotations for 1635542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720