Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635548_s_at:

>probe:Drosophila_2:1635548_s_at:228:67; Interrogation_Position=111; Antisense; ATGGACAACAGGGTGGACACGGCCA
>probe:Drosophila_2:1635548_s_at:664:407; Interrogation_Position=141; Antisense; GACGTGGTCAGCAAGGATTCGGACA
>probe:Drosophila_2:1635548_s_at:587:227; Interrogation_Position=173; Antisense; AATGGCCAACAAGGATTCGGACAGG
>probe:Drosophila_2:1635548_s_at:371:399; Interrogation_Position=201; Antisense; GACACGGCCAGCAAGGATTCGGACA
>probe:Drosophila_2:1635548_s_at:258:269; Interrogation_Position=266; Antisense; CATGGCCAGCAAGGATTCGGACACG
>probe:Drosophila_2:1635548_s_at:437:461; Interrogation_Position=279; Antisense; GATTCGGACACGGTGGACGTTACTA
>probe:Drosophila_2:1635548_s_at:152:475; Interrogation_Position=356; Antisense; GTTAAGTTTTTAATGTCGCAACACA
>probe:Drosophila_2:1635548_s_at:280:125; Interrogation_Position=416; Antisense; AGCCGATGTATTTTCTTCTTTCACG
>probe:Drosophila_2:1635548_s_at:90:713; Interrogation_Position=428; Antisense; TTCTTCTTTCACGTAAATTCTTGTA
>probe:Drosophila_2:1635548_s_at:254:707; Interrogation_Position=480; Antisense; TTAAAATTTTACACAAGCAGCGGAG
>probe:Drosophila_2:1635548_s_at:543:111; Interrogation_Position=495; Antisense; AGCAGCGGAGTTTTTCGTTTCCTAT
>probe:Drosophila_2:1635548_s_at:124:603; Interrogation_Position=70; Antisense; TGTTTTCTTCGCCTTGATCGCTGTG
>probe:Drosophila_2:1635548_s_at:679:725; Interrogation_Position=83; Antisense; TTGATCGCTGTGGTCTTTGCCGCTG
>probe:Drosophila_2:1635548_s_at:15:695; Interrogation_Position=98; Antisense; TTTGCCGCTGGCTATGGACAACAGG

Paste this into a BLAST search page for me
ATGGACAACAGGGTGGACACGGCCAGACGTGGTCAGCAAGGATTCGGACAAATGGCCAACAAGGATTCGGACAGGGACACGGCCAGCAAGGATTCGGACACATGGCCAGCAAGGATTCGGACACGGATTCGGACACGGTGGACGTTACTAGTTAAGTTTTTAATGTCGCAACACAAGCCGATGTATTTTCTTCTTTCACGTTCTTCTTTCACGTAAATTCTTGTATTAAAATTTTACACAAGCAGCGGAGAGCAGCGGAGTTTTTCGTTTCCTATTGTTTTCTTCGCCTTGATCGCTGTGTTGATCGCTGTGGTCTTTGCCGCTGTTTGCCGCTGGCTATGGACAACAGG

Full Affymetrix probeset data:

Annotations for 1635548_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime