FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635549_at:

>probe:Drosophila_2:1635549_at:435:53; Interrogation_Position=107; Antisense; ATGCATGGGCTATTCCGACGAAGAT
>probe:Drosophila_2:1635549_at:199:411; Interrogation_Position=123; Antisense; GACGAAGATCGTGAGGCTGACAACC
>probe:Drosophila_2:1635549_at:3:631; Interrogation_Position=16; Antisense; TCCGGTTTGCTTCAGCGTTCCAAAA
>probe:Drosophila_2:1635549_at:74:181; Interrogation_Position=168; Antisense; AAAAACGCCCAGGACGATGACTCCA
>probe:Drosophila_2:1635549_at:110:353; Interrogation_Position=202; Antisense; GCACCCAGGAACTACTTGACATCTA
>probe:Drosophila_2:1635549_at:397:677; Interrogation_Position=227; Antisense; TAGGCGTTTATATCCCAGTTTGACC
>probe:Drosophila_2:1635549_at:203:471; Interrogation_Position=278; Antisense; GTTCGTCAACGAGCATACGGATGCC
>probe:Drosophila_2:1635549_at:403:477; Interrogation_Position=363; Antisense; GTATCTCCAGGTGTGAAGGGCCTTG
>probe:Drosophila_2:1635549_at:706:221; Interrogation_Position=378; Antisense; AAGGGCCTTGCAACTGGATTCTTTG
>probe:Drosophila_2:1635549_at:725:205; Interrogation_Position=417; Antisense; AAGCTTGCTCAATTATTCACTGGTT
>probe:Drosophila_2:1635549_at:414:9; Interrogation_Position=526; Antisense; ATTGCCACTTAACGTTTTGTATACA
>probe:Drosophila_2:1635549_at:690:615; Interrogation_Position=55; Antisense; TGAATTCTTCAACTGCTCTTATGTG
>probe:Drosophila_2:1635549_at:700:61; Interrogation_Position=75; Antisense; ATGTGCTTTGCACTGCTGCTGATTA
>probe:Drosophila_2:1635549_at:569:333; Interrogation_Position=92; Antisense; GCTGATTAGTCCTCTATGCATGGGC

Paste this into a BLAST search page for me
ATGCATGGGCTATTCCGACGAAGATGACGAAGATCGTGAGGCTGACAACCTCCGGTTTGCTTCAGCGTTCCAAAAAAAAACGCCCAGGACGATGACTCCAGCACCCAGGAACTACTTGACATCTATAGGCGTTTATATCCCAGTTTGACCGTTCGTCAACGAGCATACGGATGCCGTATCTCCAGGTGTGAAGGGCCTTGAAGGGCCTTGCAACTGGATTCTTTGAAGCTTGCTCAATTATTCACTGGTTATTGCCACTTAACGTTTTGTATACATGAATTCTTCAACTGCTCTTATGTGATGTGCTTTGCACTGCTGCTGATTAGCTGATTAGTCCTCTATGCATGGGC

Full Affymetrix probeset data:

Annotations for 1635549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720